or
or
Exact

Results for "TNKS"

Variant Events: 31

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
TNKS     AU4444304chr8:
9569472-9569472
CTintronicDe novo--Yuen2017 G
TNKS     2-1336-003chr8:
9732272-9732272
AAAAGintergenicDe novo--Yuen2017 G
TNKS     1-0455-004chr8:
9468667-9468667
CTintronicDe novo--Yuen2017 G
TNKS     AU0146301chr8:
9581819-9581819
CTintronicDe novo--Yuen2017 G
TNKS     1-0126-003chr8:
9467916-9467916
TCintronicDe novo--Yuen2017 G
TNKS     2-1382-003chr8:
9705148-9705148
ATintergenicDe novo--Yuen2016 G
Yuen2017 G
TNKS     2-1277-004chr8:
9523358-9523358
ATintronicDe novo--Yuen2017 G
TNKS     5-0033-004chr8:
9561088-9561088
CTintronicDe novo--Yuen2017 G
TNKS     5-0055-003chr8:
9497891-9497891
TAintronicDe novo--Yuen2017 G
TNKS     2-1487-003chr8:
9603340-9603340
CGintronicDe novo--Yuen2017 G
TNKS     7-0129-003chr8:
9621399-9621413
CTTGTTTGTTTGTTTCTTGTTTGTTTintronicDe novo--Yuen2017 G
TNKS     2-0299-005chr8:
9629438-9629438
GGGGAGGGAGAAAintronicDe novo--Yuen2017 G
TNKS     2-0198-004chr8:
9564724-9564724
GAintronicDe novo--Yuen2017 G
TNKS     12026.p1chr8:
9473105-9473105
CTexonicDe novosynonymous SNVNM_003747c.C912Tp.H304H-1.816E-5Iossifov2014 E
Kosmicki2017 E
Satterstrom2020 E
TNKS     11569.p1chr8:
9567627-9567627
TCintronicDe novo--Iossifov2014 E
Kosmicki2017 E
Satterstrom2020 E
TNKS     2-1487-003chr8:
9618939-9618939
ACintronicDe novo--Yuen2017 G
TNKS     11569.p1chr8:
9567684-9567684
GCexonicDe novononsynonymous SNVNM_003747c.G1703Cp.R568T18.48-Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Krupp2017 E
O’Roak2012b E
Satterstrom2020 E
Wilfert2021 G
TNKS     12175.p1chr8:
9505265-9505265
AGintronicDe novo--Turner2016 G
TNKS     G01-GEA-260-HIchr8:
9623248-9623248
GCexonicDe novononsynonymous SNVNM_003747c.G3494Cp.R1165P33.0-Satterstrom2020 E
TNKS     2-1317-003chr8:
9625630-9625630
CTintronicDe novo--Yuen2016 G
Yuen2017 G
TNKS     SSC05223chr8:
9473105-9473105
CTexonicDe novosynonymous SNVNM_003747c.C912Tp.H304H-1.816E-5Lim2017 E
TNKS     G01-GEA-163-HIchr8:
9634110-9634110
AGintronicDe novo--Satterstrom2020 E
TNKS     1-0292-005chr8:
9621972-9621972
GAintronicDe novo--Yuen2017 G
TNKS     1-0826-004chr8:
9484536-9484536
CAintronicDe novo--Yuen2017 G
TNKS     2-0198-005chr8:
9564724-9564724
GAintronicDe novo--Yuen2017 G
TNKS     7-0248-003chr8:
9431903-9431903
CAintronicDe novo--Yuen2017 G
TNKS     2-1215-003chr8:
9716334-9716334
CTintergenicDe novo--Yuen2017 G
TNKS     AU2427303chr8:
9698819-9698819
ATintergenicDe novo--Yuen2017 G
TNKS     AU4444304chr8:
9564321-9564321
CGexonicDe novononsynonymous SNVNM_003747c.C1270Gp.H424D22.0-Yuen2017 G
TNKS     AU4444304chr8:
9568639-9568639
GCintronicDe novo--Yuen2017 G
TNKS     1-0520-003chr8:
9530828-9530828
GCintronicDe novo--Yuen2016 G
Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More