or
or
Exact

Results for "EFCAB2"

Variant Events: 14

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
EFCAB2     7-0171-003chr1:
245270702-245270702
AGintronicDe novo--Yuen2017 G
EFCAB2     7-0024-003chr1:
245281059-245281059
CTintronicDe novo--Yuen2017 G
EFCAB2     12795.p1chr1:
245280588-245280588
TCintronicDe novo--Turner2016 G
EFCAB2     2-1526-003chr1:
245136533-245136533
AATAATAATTTTGGCAATATACintronicDe novo--Yuen2017 G
EFCAB2     14015.p1chr1:
245180399-245180399
AGintronicDe novo--Turner2016 G
Werling2018 G
EFCAB2     2-1466-003chr1:
245153523-245153523
CTintronicDe novo--Yuen2016 G
EFCAB2     7-0058-003chr1:
245136533-245136533
AATAATAATTTTGGCAATATACintronicDe novo--Yuen2017 G
EFCAB2     2-0310-003chr1:
245136533-245136533
AATAATAATTTTGGCAATATACintronicDe novo--Yuen2017 G
EFCAB2     1-0530-003chr1:
245212696-245212696
GAintronicDe novo--Yuen2016 G
Yuen2017 G
EFCAB2     2-1359-003chr1:
245225945-245225945
GAintronicDe novo--Yuen2017 G
EFCAB2     11382.p1chr1:
245250572-245250572
GTexonicMosaicnonsynonymous SNVNM_001290327
NM_032328
c.G429T
c.G399T
p.M143I
p.M133I
15.84-Krupp2017 E
EFCAB2     5-0131-003chr1:
245136533-245136533
AATAATAATTTTGGCAATATACintronicDe novo--Yuen2017 G
EFCAB2     AU2139301chr1:
245201704-245201704
GAintronicDe novo--Yuen2017 G
EFCAB2     1-0336-003chr1:
245136533-245136533
AATAATAATTTTGGCAATATACintronicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More