or
or
Exact

Results for "TCF7L2"

Variant Events: 53

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
TCF7L2     5-0065-003chr10:
115131912-115131912
CTintergenicDe novo--Yuen2017 G
TCF7L2     2-1350-003chr10:
114867298-114867298
CTintronicDe novo--Yuen2017 G
TCF7L2     AU3906301chr10:
115068003-115068003
TCintergenicDe novo--Yuen2017 G
TCF7L2     HEN494.p1chr10:
114903718-114903718
CTexonicUnknownnonsynonymous SNVNM_001198530
NM_001146284
NM_001146285
NM_001146286
NM_001198525
NM_001198526
NM_001198527
NM_001198528
NM_001198529
NM_030756
NM_001146274
NM_001146283
NM_001198531
c.C551T
c.C653T
c.C653T
c.C653T
c.C653T
c.C653T
c.C653T
c.C653T
c.C653T
c.C653T
c.C722T
c.C794T
c.C722T
p.P184L
p.P218L
p.P218L
p.P218L
p.P218L
p.P218L
p.P218L
p.P218L
p.P218L
p.P218L
p.P241L
p.P265L
p.P241L
25.4-Wang2020 T
Wang2020 T
TCF7L2     13069.p1chr10:
114901076-114901076
GAsplicingMosaic, De novosplicing29.5-Dou2017 E
Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Lim2017 E
O’Roak2014 T
Satterstrom2020 E
Turner2016 G
Turner2017 G
Wang2020 T
TCF7L2     HEN0392.p1chr10:
114903688-114903688
CTexonicUnknownnonsynonymous SNVNM_001198530
NM_001146284
NM_001146285
NM_001146286
NM_001198525
NM_001198526
NM_001198527
NM_001198528
NM_001198529
NM_030756
NM_001146274
NM_001146283
NM_001198531
c.C521T
c.C623T
c.C623T
c.C623T
c.C623T
c.C623T
c.C623T
c.C623T
c.C623T
c.C623T
c.C692T
c.C764T
c.C692T
p.P174L
p.P208L
p.P208L
p.P208L
p.P208L
p.P208L
p.P208L
p.P208L
p.P208L
p.P208L
p.P231L
p.P255L
p.P231L
22.8-Wang2020 T
Wang2020 T
TCF7L2     12090.p1chr10:
114910883-114910883
GAsplicingMosaic, De novosplicing19.91-Dou2017 E
Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Krupp2017 E
O’Roak2014 T
Satterstrom2020 E
Wang2020 T
Wilfert2021 G
TCF7L2     225991chr10:
114925475-114925475
CTexonicUnknownnonsynonymous SNVNM_001146285
NM_001198526
NM_001146274
NM_030756
c.C1484T
c.C1484T
c.C1553T
c.C1535T
p.S495L
p.S495L
p.S518L
p.S512L
20.32.499E-5Wang2020 T
Wang2020 T
Wang2020 T
TCF7L2     AU4219302chr10:
114722696-114722696
GAintronicDe novo--Yuen2017 G
TCF7L2     2-0219-004chr10:
115054030-115054030
TCintergenicDe novo--Yuen2017 G
TCF7L2     2-1138-003chr10:
114929682-114929682
CAintergenicDe novo--Yuen2017 G
TCF7L2     2-0219-004chr10:
114920870-114920870
GAintronicDe novo--Yuen2017 G
TCF7L2     7-0249-004chr10:
115225853-115225853
ATintergenicDe novo--Yuen2017 G
TCF7L2     1-0126-003chr10:
115075225-115075225
CTintergenicDe novo--Yuen2017 G
TCF7L2     AU1933302chr10:
115248576-115248576
CTintergenicDe novo--Yuen2017 G
TCF7L2     AU4013302chr10:
114806972-114806972
GAintronicDe novo--Yuen2017 G
TCF7L2     11520.p1chr10:
115087888-115087888
CAintergenicDe novo--Werling2018 G
TCF7L2     7-0255-003chr10:
115217203-115217203
TCintergenicDe novo--Yuen2017 G
TCF7L2     Lim2017:35906chr10:
114910883-114910883
GAsplicingDe novosplicing19.91-Lim2017 E
TCF7L2     2-1330-003chr10:
115168608-115168608
CAintergenicDe novo--Yuen2016 G
Yuen2017 G
TCF7L2     7-0223-003chr10:
115105994-115106000
GAAAAAAGAAAAintergenicDe novo--Yuen2017 G
TCF7L2     1-0368-004chr10:
114920669-114920669
CGintronicDe novo--Yuen2017 G
TCF7L2     3-0246-000chr10:
114716580-114716580
AGintronicDe novo--Yuen2017 G
TCF7L2     AU4197301chr10:
115061504-115061504
CTintergenicDe novo--Yuen2017 G
TCF7L2     2-1327-004chr10:
115183394-115183394
CTintergenicDe novo--Yuen2017 G
TCF7L2     7-0253-003chr10:
115297342-115297342
GAintergenicDe novo--Yuen2017 G
TCF7L2     AU3605303chr10:
115164626-115164663
CTTTTTTTTTCTTTTTTTTTTTTTTTTTTTTTTTTTTTCTTTTTTTTTintergenicDe novo--Yuen2017 G
TCF7L2     AU3918302chr10:
114769237-114769237
AGintronicDe novo--Yuen2017 G
TCF7L2     1-0566-003chr10:
114982065-114982065
GAintergenicDe novo--Yuen2017 G
TCF7L2     13888.p1chr10:
114849308-114849308
CTintronicDe novo-6.733E-5Krumm2015 E
Satterstrom2020 E
TCF7L2     M32029chr10:
114925726-114925726
GTexonicPaternalstopgainNM_001146285
NM_001198526
NM_001146274
NM_030756
c.G1735T
c.G1735T
c.G1804T
c.G1786T
p.E579X
p.E579X
p.E602X
p.E596X
42.0-Guo2018 T
Wang2020 T
Wang2020 T
TCF7L2     2-1278-003chr10:
115149186-115149186
GAintergenicDe novo--Yuen2017 G
TCF7L2     A12chr10:
114909589-114909589
TCintronicDe novo--Wu2018 G
TCF7L2     1-0497-003chr10:
115291713-115291713
CTintergenicDe novo--Yuen2017 G
TCF7L2     3-0469-000chr10:
115141037-115141037
CTintergenicDe novo--Yuen2017 G
TCF7L2     14522.p1chr10:
115263958-115263958
GAintergenicDe novo--Werling2018 G
TCF7L2     3-0469-000chr10:
115150394-115150394
AGintergenicDe novo--Yuen2017 G
TCF7L2     AU2793303chr10:
115013073-115013073
ATintergenicDe novo--Yuen2017 G
TCF7L2     AU1448301chr10:
115207583-115207583
TCintergenicDe novo--Yuen2017 G
TCF7L2     00963-V9V2Wchr10:
114925334-114925334
GTexonicUnknownnonsynonymous SNVNM_001198530
NM_001146286
NM_001146283
NM_001146284
NM_001146285
NM_001198526
NM_001198529
NM_001198531
NM_001146274
NM_030756
c.G1168T
c.G1270T
c.G1411T
c.G1309T
c.G1343T
c.G1343T
c.G1321T
c.G1339T
c.G1412T
c.G1394T
p.A390S
p.A424S
p.A471S
p.A437S
p.R448L
p.R448L
p.A441S
p.A447S
p.R471L
p.R465L
28.4-Wang2020 T
Wang2020 T
TCF7L2     AU1742302chr10:
114948275-114948275
GAintergenicDe novo--Yuen2017 G
TCF7L2     60244430chr10:
114925406-114925406
CAexonicUnknownnonsynonymous SNVNM_001146285
NM_001198526
NM_001146274
NM_030756
c.C1415A
c.C1415A
c.C1484A
c.C1466A
p.P472H
p.P472H
p.P495H
p.P489H
18.160.0025Wang2020 T
Wang2020 T
TCF7L2     1-0652-004chr10:
115217675-115217675
GAintergenicDe novo--Yuen2017 G
TCF7L2     2-1246-003chr10:
115055447-115055447
GGACTCCACintergenicDe novo--Yuen2017 G
TCF7L2     BK877-01chr10:
114925406-114925406
CAexonicUnknownnonsynonymous SNVNM_001146285
NM_001198526
NM_001146274
NM_030756
c.C1415A
c.C1415A
c.C1484A
c.C1466A
p.P472H
p.P472H
p.P495H
p.P489H
18.160.0025Wang2020 T
Wang2020 T
Wang2020 T
TCF7L2     SF0022463.p1chr10:
114799783-114799783
GCsplicingDe novosplicing21.0-Wang2020 T
TCF7L2     219-2316-0001chr10:
114910852-114910852
CTexonicUnknownnonsynonymous SNVNM_001198530
NM_001146284
NM_001146285
NM_001146286
NM_001198525
NM_001198526
NM_001198527
NM_001198528
NM_001198529
NM_030756
NM_001146274
NM_001146283
NM_001198531
c.C800T
c.C890T
c.C902T
c.C902T
c.C917T
c.C902T
c.C890T
c.C902T
c.C902T
c.C902T
c.C971T
c.C1043T
c.C971T
p.S267F
p.S297F
p.S301F
p.S301F
p.S306F
p.S301F
p.S297F
p.S301F
p.S301F
p.S301F
p.S324F
p.S348F
p.S324F
24.0-Stessman2017 T
Wang2020 T
Wang2020 T
TCF7L2     AU3861303chr10:
115072701-115072701
GAintergenicDe novo--Yuen2017 G
TCF7L2     SF0048058.p1chr10:
114919742-114919742
GAexonicDe novononsynonymous SNVNM_001146285
NM_001198525
NM_001198527
NM_001198528
NM_030756
c.G1313A
c.G1379A
c.G1352A
c.G1364A
c.G1364A
p.G438D
p.G460D
p.G451D
p.G455D
p.G455D
13.45-Wang2020 T
TCF7L2     SF0070682.p1chr10:
114912173-114912173
CGexonicDe novononsynonymous SNVNM_001198530
NM_001146284
NM_001146285
NM_001146286
NM_001198525
NM_001198526
NM_001198527
NM_001198528
NM_001198529
NM_030756
NM_001146274
NM_001146283
NM_001198531
c.C1072G
c.C1162G
c.C1174G
c.C1174G
c.C1189G
c.C1174G
c.C1162G
c.C1174G
c.C1174G
c.C1174G
c.C1243G
c.C1315G
c.C1243G
p.P358A
p.P388A
p.P392A
p.P392A
p.P397A
p.P392A
p.P388A
p.P392A
p.P392A
p.P392A
p.P415A
p.P439A
p.P415A
31.0-Wang2020 T
TCF7L2     2-1397-003chr10:
114753264-114753287
CAAAAAAAGAAAAAAAAAAGAAAACAAAAAAAGAAAAintronicDe novo--Yuen2017 G
TCF7L2     1-0453-003chr10:
115268362-115268362
ATintergenicDe novo--Yuen2017 G
TCF7L2     1-0079-008chr10:
115197559-115197559
GAintergenicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More