or
or
Exact

Results for "CSMD1"

Variant Events: 396

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
CSMD1     1-0253-004chr8:
3806772-3806772
ACintronicDe novo--Yuen2017 G
CSMD1     2-1305-003chr8:
4317594-4317594
GCintronicDe novo--Yuen2016 G
Yuen2017 G
CSMD1     AU4219302chr8:
3554496-3554496
GCintronicDe novo--Yuen2017 G
CSMD1     12650.p1chr8:
3253768-3253768
CTexonicMosaicsynonymous SNVNM_033225c.G2541Ap.L847L0.0260.4527Dou2017 E
CSMD1     AU4219302chr8:
3577173-3577173
GTintronicDe novo--Yuen2017 G
CSMD1     2-1305-003chr8:
4303137-4303137
GAintronicDe novo--Yuen2016 G
Yuen2017 G
CSMD1     2-1093-009chr8:
2985711-2985711
TAintronicDe novo--Yuen2017 G
CSMD1     1-0487-003chr8:
3238143-3238143
CTintronicDe novo--Yuen2016 G
Yuen2017 G
CSMD1     2-1093-009chr8:
2959685-2959685
ATintronicDe novo--Yuen2017 G
CSMD1     2-1521-003chr8:
5147182-5147182
TCintergenicDe novo--Yuen2017 G
CSMD1     AU1795302chr8:
5929781-5929781
TCintergenicDe novo--Yuen2017 G
CSMD1     1-0300-004chr8:
3210414-3210414
GAintronicDe novo--Yuen2017 G
CSMD1     AU2988302chr8:
4682141-4682141
GCintronicDe novo--Yuen2017 G
CSMD1     AU4237302chr8:
4858900-4858900
GTintergenicDe novo--Yuen2017 G
CSMD1     2-1322-004chr8:
6179648-6179648
GAintergenicDe novo--Yuen2017 G
CSMD1     AU3861302chr8:
4175257-4175257
TGintronicDe novo--Yuen2017 G
CSMD1     1-0498-003chr8:
5571105-5571105
GAintergenicDe novo--Yuen2017 G
CSMD1     2-0306-003chr8:
3288995-3288995
GAintronicDe novo--Yuen2016 G
CSMD1     AU060803chr8:
4062388-4062388
CTintronicDe novo--Yuen2017 G
CSMD1     AU060803chr8:
4063872-4063872
CGintronicDe novo--Yuen2017 G
CSMD1     AU060803chr8:
4065729-4065729
AGintronicDe novo--Yuen2017 G
CSMD1     1-0330-003chr8:
3344945-3344945
GAintronicDe novo--Yuen2017 G
CSMD1     1-0671-003chr8:
5521627-5521627
CTintergenicDe novo--Yuen2017 G
CSMD1     5-0125-003chr8:
5541699-5541699
TCintergenicDe novo--Yuen2017 G
CSMD1     1-0447-003chr8:
4671467-4671467
ATintronicDe novo--Yuen2017 G
CSMD1     1-0862-003chr8:
3050117-3050117
CTintronicDe novo--Yuen2017 G
CSMD1     1-0976-003chr8:
5575489-5575489
TCintergenicDe novo--Yuen2017 G
CSMD1     1-0976-003chr8:
4728330-4728330
GAintronicDe novo--Yuen2017 G
CSMD1     AU3794301chr8:
4060037-4060037
AGintronicDe novo--Yuen2017 G
CSMD1     AU3727303chr8:
4144226-4144226
GCintronicDe novo--Yuen2017 G
CSMD1     AU0864301chr8:
2954369-2954369
AGsplicingInheritedsplicing22.5-Stessman2017 T
CSMD1     Cukier2014:37117chr8:
2965294-2965294
GCexonicUnknownnonsynonymous SNVNM_033225c.C6781Gp.P2261A15.420.0042Cukier2014 E
CSMD1     Cukier2014:17122chr8:
3253832-3253832
CTexonicUnknownnonsynonymous SNVNM_033225c.G2477Ap.G826D16.61-Cukier2014 E
CSMD1     1-0065-005chr8:
6008048-6008048
GGAAAAGAAAGGGAAAGGGAAAGGAAAGTintergenicDe novo--Yuen2017 G
CSMD1     2-1317-003chr8:
3410119-3410119
TCintronicDe novo--Yuen2016 G
CSMD1     12906.p1chr8:
2965314-2965314
TCexonicDe novononsynonymous SNVNM_033225c.A6761Gp.Q2254R1.421-Iossifov2014 E
Kosmicki2017 E
Krupp2017 E
Satterstrom2020 E
Wilfert2021 G
CSMD1     14695.p1chr8:
3046533-3046533
ATexonicDe novononsynonymous SNVNM_033225c.T5399Ap.V1800E16.27-Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Satterstrom2020 E
Wilfert2021 G
CSMD1     14165.p1chr8:
3165969-3165969
GAexonicDe novononsynonymous SNVNM_033225c.C3688Tp.R1230C15.04-Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Krupp2017 E
Lim2017 E
Satterstrom2020 E
Wilfert2021 G
CSMD1     7-0175-003chr8:
3892953-3892953
CGintronicDe novo--Yuen2017 G
CSMD1     7-0175-003chr8:
4031497-4031497
CGintronicDe novo--Yuen2017 G
CSMD1     AU3125301chr8:
3133893-3133893
GAintronicDe novo--Yuen2017 G
CSMD1     AU3846302chr8:
4202784-4202784
TCintronicDe novo--Yuen2017 G
CSMD1     1-0191-004chr8:
4230113-4230113
ATintronicDe novo--Yuen2017 G
CSMD1     AU2029302chr8:
4707812-4707812
ACintronicDe novo--Yuen2017 G
CSMD1     7-0175-003chr8:
4192950-4192950
ATintronicDe novo--Yuen2017 G
CSMD1     7-0175-003chr8:
5107487-5107487
TCintergenicDe novo--Yuen2017 G
CSMD1     AU1573301chr8:
2857552-2857552
GAexonicUnknownnonsynonymous SNVNM_033225c.C8131Tp.R2711W15.95.798E-5Stessman2017 T
CSMD1     AU2988303chr8:
4682141-4682141
GCintronicDe novo--Yuen2017 G
CSMD1     2-1266-003chr8:
5644364-5644364
ATintergenicDe novo--Yuen2016 G
Yuen2017 G
CSMD1     2-1325-003chr8:
4090338-4090338
AGintronicDe novo--Yuen2017 G
CSMD1     1-0464-003chr8:
3302074-3302074
ACintronicDe novo--Yuen2017 G
CSMD1     7-0008-003chr8:
3648885-3648885
AGintronicDe novo--Yuen2017 G
CSMD1     2-1722-003chr8:
3152451-3152451
GTintronicDe novo--Yuen2017 G
CSMD1     AU2410302chr8:
3326800-3326800
TCintronicDe novo--Yuen2017 G
CSMD1     AU024105chr8:
3056101-3056101
CAintronicDe novo--Yuen2017 G
CSMD1     AU3371303chr8:
5780588-5780590
CTGCintergenicDe novo--Yuen2017 G
CSMD1     1-0485-003chr8:
3233889-3233889
CAintronicDe novo--Yuen2017 G
CSMD1     AU079204chr8:
2817647-2817647
AGintronicDe novo--Yuen2017 G
CSMD1     1-0763-004chr8:
4253499-4253501
TTCTintronicDe novo--Yuen2017 G
CSMD1     3-0396-000chr8:
6207435-6207435
CTintergenicDe novo--Yuen2016 G
CSMD1     AU1987302chr8:
5411725-5411725
TCintergenicDe novo--Yuen2017 G
CSMD1     A16chr8:
3970295-3970295
GTintronicDe novo--Wu2018 G
CSMD1     1-0406-003chr8:
4634486-4634486
TCintronicDe novo--Yuen2017 G
CSMD1     AU3728301chr8:
5547994-5547994
CTintergenicDe novo--Yuen2017 G
CSMD1     1-0289-004chr8:
4311182-4311182
ACintronicDe novo--Yuen2017 G
CSMD1     2-1348-003chr8:
3157817-3157817
ACintronicDe novo--Yuen2017 G
CSMD1     1-0448-003chr8:
3788422-3788422
CTintronicDe novo--Yuen2017 G
CSMD1     2-1429-004chr8:
3683107-3683107
GCintronicDe novo--Yuen2017 G
CSMD1     AU4286302chr8:
3229637-3229637
GCintronicDe novo--Yuen2017 G
CSMD1     2-1177-003chr8:
5282635-5282635
GAintergenicDe novo--Yuen2016 G
Yuen2017 G
CSMD1     1-0638-003chr8:
4053734-4053756
AAAATAAATAAATAAATAAATAAAAAATAAATAAATAAATAAintronicDe novo--Yuen2017 G
CSMD1     AU3846303chr8:
3590239-3590239
TAintronicDe novo--Yuen2017 G
CSMD1     2-1460-003chr8:
5032931-5032931
TCintergenicDe novo--Yuen2017 G
CSMD1     AU3846303chr8:
5229960-5229960
AGintergenicDe novo--Yuen2017 G
CSMD1     2-1094-005chr8:
2943584-2943584
CTintronicDe novo--Yuen2017 G
CSMD1     Y6P6Jchr8:
2836280-2836280
CTexonicUnknownnonsynonymous SNVNM_033225c.G8420Ap.R2807H15.081.803E-5Stessman2017 T
CSMD1     AU2109302chr8:
6030575-6030575
TCintergenicDe novo--Yuen2017 G
CSMD1     AU2029303chr8:
4707812-4707812
ACintronicDe novo--Yuen2017 G
CSMD1     AU047703chr8:
5834677-5834677
GAintergenicDe novo--Yuen2017 G
CSMD1     3C548chr8:
3216817-3216817
CAexonicDe novononsynonymous SNVNM_033225c.G3161Tp.S1054I24.7-Satterstrom2020 E
CSMD1     2-0299-005chr8:
5755444-5755444
TTAATCintergenicDe novo--Yuen2017 G
CSMD1     AU1987304chr8:
5237064-5237064
TGintergenicDe novo--Yuen2017 G
CSMD1     ASC_CA_181_Achr8:
3265421-3265421
TCexonicDe novononsynonymous SNVNM_033225c.A2071Gp.T691A21.6-Satterstrom2020 E
CSMD1     2-1317-003chr8:
5727830-5727830
CTintergenicDe novo--Yuen2016 G
Yuen2017 G
CSMD1     AU4007301chr8:
4235854-4235854
TAintronicDe novo--Yuen2017 G
CSMD1     2-1215-003chr8:
5615500-5615500
TAintergenicDe novo--Yuen2017 G
CSMD1     AU072504chr8:
5255297-5255297
GAintergenicDe novo--Yuen2017 G
CSMD1     AU4228302chr8:
4418919-4418919
TAintronicDe novo--Yuen2017 G
CSMD1     AU4228302chr8:
6021077-6021077
GAintergenicDe novo--Yuen2017 G
CSMD1     188-03-100416chr8:
3057284-3057284
TAexonicDe novononsynonymous SNVNM_033225c.A5146Tp.S1716C20.3-Satterstrom2020 E
CSMD1     7-0255-003chr8:
6041809-6041809
AGintergenicDe novo--Yuen2017 G
CSMD1     AU4306302chr8:
3023971-3023971
GAintronicDe novo--Yuen2017 G
CSMD1     AU057405chr8:
4007216-4007216
GCintronicDe novo--Yuen2017 G
CSMD1     14370.p1chr8:
3192222-3192222
GAintronicDe novo--Turner2016 G
CSMD1     AU066404chr8:
3630997-3630997
TCintronicDe novo--Yuen2017 G
CSMD1     AU066404chr8:
6238005-6238005
AGintergenicDe novo--Yuen2017 G
CSMD1     14496.p1chr8:
6007570-6007570
TAintergenicDe novo--Turner2016 G
CSMD1     2-1466-003chr8:
3416043-3416043
GCintronicDe novo--Yuen2017 G
CSMD1     2-1466-003chr8:
3416038-3416038
AGintronicDe novo--Yuen2017 G
CSMD1     12498.p1chr8:
3693168-3693168
GAintronicDe novo--Turner2016 G
CSMD1     AU3907302chr8:
3429544-3429544
GCintronicDe novo--Yuen2017 G
CSMD1     14642.p1chr8:
5213785-5213785
ATintergenicDe novo--Turner2016 G
CSMD1     7-0023-003chr8:
5965812-5965812
GAintergenicDe novo--Yuen2017 G
CSMD1     AU0540301chr8:
3203356-3203356
TGintronicDe novo--Yuen2017 G
CSMD1     2-1409-003chr8:
5518808-5518808
GAintergenicDe novo--Yuen2016 G
Yuen2017 G
CSMD1     AU0540301chr8:
5286261-5286261
TGintergenicDe novo--Yuen2017 G
CSMD1     2-1364-003chr8:
5124894-5124894
GTintergenicDe novo--Yuen2017 G
CSMD1     M16119chr8:
2796128-2796128
GTexonicUnknownnonsynonymous SNVNM_033225c.C10674Ap.N3558K27.8-Stessman2017 T
CSMD1     M16226chr8:
2813237-2813237
CTexonicUnknownnonsynonymous SNVNM_033225c.G9868Ap.D3290N15.031.656E-5Stessman2017 T
CSMD1     2-1337-003chr8:
4729450-4729450
TCintronicDe novo--Yuen2016 G
Yuen2017 G
CSMD1     AU2569303chr8:
5231675-5231675
TAintergenicDe novo--Yuen2017 G
CSMD1     7-0104-003chr8:
3208540-3208540
TGintronicDe novo--Yuen2017 G
CSMD1     7-0248-003chr8:
4878283-4878283
CTintergenicDe novo--Yuen2017 G
CSMD1     AU2863303chr8:
2892700-2892700
TCintronicDe novo--Yuen2017 G
CSMD1     2-1281-003chr8:
5115797-5115797
TAintergenicDe novo--Yuen2017 G
CSMD1     A19chr8:
3159216-3159216
CTintronicDe novo--Wu2018 G
CSMD1     5-0131-003chr8:
4272361-4272361
AGintronicDe novo--Yuen2017 G
CSMD1     1-0565-004chr8:
5060330-5060330
AGintergenicDe novo--Yuen2017 G
CSMD1     AU3807302chr8:
6176889-6176889
GCintergenicDe novo--Yuen2017 G
CSMD1     2-1350-004chr8:
4436291-4436291
GAintronicDe novo--Yuen2017 G
CSMD1     AU3807302chr8:
6178084-6178084
GAintergenicDe novo--Yuen2017 G
CSMD1     210-18227-302chr8:
2823423-2823423
CTexonicUnknownnonsynonymous SNVNM_033225c.G9154Ap.D3052N24.12.36E-5Stessman2017 T
CSMD1     AU4231301chr8:
4668168-4668168
GCintronicDe novo--Yuen2017 G
CSMD1     1-0272-004chr8:
4872890-4872890
CTintergenicDe novo--Yuen2017 G
CSMD1     A2chr8:
5569229-5569229
CTintergenicDe novo--Wu2018 G
CSMD1     AU3716302chr8:
3170025-3170025
GCintronicDe novo--Yuen2017 G
CSMD1     7-0188-003chr8:
5242015-5242015
CAintergenicDe novo--Yuen2017 G
CSMD1     2-1730-003chr8:
4115379-4115379
CGintronicDe novo--Yuen2017 G
CSMD1     2-0318-003chr8:
3509877-3509877
GGAGCACCTACCACintronicDe novo--Yuen2017 G
CSMD1     AC04-1008-04chr8:
3265577-3265577
CTexonicDe novononsynonymous SNVNM_033225c.G1915Ap.A639T4.4461.658E-5DeRubeis2014 E
Kosmicki2017 E
Satterstrom2020 E
CSMD1     2-0214-003chr8:
5221061-5221061
GAintergenicDe novo--Yuen2017 G
CSMD1     1-0022-004chr8:
2831598-2831598
AGintronicDe novo--Yuen2017 G
CSMD1     AU006804chr8:
3324692-3324692
GCintronicDe novo--Yuen2017 G
CSMD1     AU1988302chr8:
5671679-5671679
CGintergenicDe novo--Yuen2017 G
CSMD1     1-0353-003chr8:
2959078-2959078
GCintronicDe novo--Yuen2017 G
CSMD1     AU1988302chr8:
5678128-5678128
ATintergenicDe novo--Yuen2017 G
CSMD1     AU1988302chr8:
5683937-5683937
CGintergenicDe novo--Yuen2017 G
CSMD1     AU1988302chr8:
5685374-5685374
AGintergenicDe novo--Yuen2017 G
CSMD1     AU1988302chr8:
5685671-5685671
AGintergenicDe novo--Yuen2017 G
CSMD1     2-0102-004chr8:
4820252-4820252
GTintronicDe novo--Yuen2017 G
CSMD1     2-1228-003chr8:
4943979-4943979
ATintergenicDe novo--Yuen2016 G
Yuen2017 G
CSMD1     AU3779302chr8:
3152098-3152098
GAintronicDe novo--Yuen2017 G
CSMD1     1-0417-003chr8:
5734139-5734139
ACintergenicDe novo--Yuen2017 G
CSMD1     1-0467-003chr8:
3703845-3703845
CGintronicDe novo--Yuen2017 G
CSMD1     1-0210-004chr8:
4354112-4354112
GCintronicDe novo--Yuen2017 G
CSMD1     AU058103chr8:
3638597-3638597
GAintronicDe novo--Yuen2017 G
CSMD1     AU4487302chr8:
5703318-5703321
CATGCintergenicDe novo--Yuen2017 G
CSMD1     7-0191-003chr8:
3046624-3046624
TCintronicDe novo--Yuen2017 G
CSMD1     1-0112-004chr8:
6183429-6183429
AAGintergenicDe novo--Yuen2017 G
CSMD1     1-0513-003chr8:
5325585-5325585
CTintergenicDe novo--Yuen2017 G
CSMD1     2-0318-004chr8:
3509877-3509877
GGAGCACCTACCACintronicDe novo--Yuen2017 G
CSMD1     AU4093301chr8:
3415772-3415772
AGintronicDe novo--Yuen2017 G
CSMD1     2-0704-003chr8:
4262580-4262580
TGintronicDe novo--Yuen2016 G
Yuen2017 G
CSMD1     2-0704-003chr8:
4374551-4374551
GAintronicDe novo--Yuen2016 G
Yuen2017 G
CSMD1     1-0558-003chr8:
4875514-4875514
CTintergenicDe novo--Yuen2017 G
CSMD1     1-0490-003chr8:
3306831-3306831
GAintronicDe novo--Yuen2017 G
CSMD1     1-0490-003chr8:
3306082-3306082
GCintronicDe novo--Yuen2017 G
CSMD1     217-14301-4220chr8:
2806838-2806838
ATexonicUnknownnonsynonymous SNVNM_033225c.T10385Ap.F3462Y18.88-Stessman2017 T
CSMD1     AU3635301chr8:
5397883-5397883
TCintergenicDe novo--Yuen2017 G
CSMD1     AU015903chr8:
3567808-3567808
AGintronicDe novo--Yuen2017 G
CSMD1     AU015903chr8:
3580701-3580701
CTintronicDe novo--Yuen2017 G
CSMD1     AU015903chr8:
3584442-3584442
CGintronicDe novo--Yuen2017 G
CSMD1     AU015903chr8:
3592620-3592620
CTintronicDe novo--Yuen2017 G
CSMD1     AU007503chr8:
5227923-5227923
TAintergenicDe novo--Yuen2017 G
CSMD1     60-2027chr8:
3282097-3282097
AGintronicDe novo--Michaelson2012 G
CSMD1     AU015903chr8:
5289975-5289975
AGintergenicDe novo--Yuen2017 G
CSMD1     74-0355chr8:
3885235-3885235
GTintronicDe novo--Michaelson2012 G
CSMD1     AU048206chr8:
3325688-3325688
GAintronicDe novo--Yuen2017 G
CSMD1     AU048206chr8:
3325722-3325722
ACintronicDe novo--Yuen2017 G
CSMD1     60-2027chr8:
4133844-4133844
CTintronicInherited--Michaelson2012 G
CSMD1     74-0075chr8:
5227923-5227923
TAintergenicDe novo--Michaelson2012 G
CSMD1     74-0355chr8:
3905290-3905290
GCintronicDe novo--Michaelson2012 G
CSMD1     60-2027chr8:
4128798-4128798
GTintronicDe novo--Michaelson2012 G
CSMD1     74-0355chr8:
5903507-5903507
ATintergenicDe novo--Michaelson2012 G
CSMD1     5-0137-003chr8:
3336261-3336261
CGintronicDe novo--Yuen2017 G
CSMD1     AU3874302chr8:
3999988-3999988
TCintronicDe novo--Yuen2017 G
CSMD1     1-0051-005chr8:
3324751-3324751
GAintronicDe novo--Yuen2017 G
CSMD1     1-0321-004chr8:
5589868-5589868
GGTAintergenicDe novo--Yuen2017 G
CSMD1     5-0077-003chr8:
5398683-5398683
TAintergenicDe novo--Yuen2017 G
CSMD1     1-0652-003chr8:
4361205-4361205
CTintronicDe novo--Yuen2017 G
CSMD1     A8chr8:
3750149-3750149
CAintronicDe novo--Wu2018 G
CSMD1     2-0289-003chr8:
3734555-3734555
GAintronicDe novo--Yuen2017 G
CSMD1     2-1120-003chr8:
5549588-5549588
GAintergenicDe novo--Yuen2017 G
CSMD1     AU2950302chr8:
5297043-5297043
CGintergenicDe novo--Yuen2017 G
CSMD1     1-0520-003chr8:
3646720-3646720
CTintronicDe novo--Yuen2017 G
CSMD1     2-1355-004chr8:
5313088-5313088
GTintergenicDe novo--Yuen2017 G
CSMD1     AU4314302chr8:
6186191-6186191
GAintergenicDe novo--Yuen2017 G
CSMD1     AU031403chr8:
3221514-3221514
GCintronicDe novo--Yuen2017 G
CSMD1     AU3053301chr8:
4626420-4626420
TCintronicDe novo--Yuen2017 G
CSMD1     13742.p1chr8:
3674758-3674758
GGTCAintronicMaternal--Wilfert2021 G
CSMD1     2-1235-003chr8:
4441684-4441684
GTintronicDe novo--Yuen2017 G
CSMD1     2-1235-003chr8:
4431869-4431869
GCintronicDe novo--Yuen2017 G
CSMD1     2-1366-004chr8:
4778611-4778611
AAGAAGintronicDe novo--Yuen2017 G
CSMD1     1-0567-003chr8:
6141094-6141094
AACATTCATCCACCCATCCATCCGTCCATTCGTCCATCCATTintergenicDe novo--Yuen2017 G
CSMD1     2-1417-003chr8:
5254811-5254811
AGintergenicDe novo--Yuen2017 G
CSMD1     AU3782302chr8:
5226308-5226308
GCintergenicDe novo--Yuen2017 G
CSMD1     AU3782302chr8:
5232474-5232474
GAintergenicDe novo--Yuen2017 G
CSMD1     1-0160-004chr8:
4451503-4451503
CGintronicDe novo--Yuen2017 G
CSMD1     1-0233-004chr8:
5346155-5346155
GTintergenicDe novo--Yuen2017 G
CSMD1     1-0160-004chr8:
4238979-4238979
CTintronicDe novo--Yuen2017 G
CSMD1     AU017304chr8:
4299792-4299792
AGintronicDe novo--Yuen2017 G
CSMD1     5-0138-003chr8:
5149245-5149245
GTintergenicDe novo--Yuen2017 G
CSMD1     13266.p1chr8:
3166067-3166067
GAintronicDe novo--Satterstrom2020 E
CSMD1     1-0433-004chr8:
4935346-4935346
GCintergenicDe novo--Yuen2017 G
CSMD1     1-0469-003chr8:
3875170-3875170
GCintronicDe novo--Yuen2017 G
CSMD1     1-0382-003chr8:
3622465-3622465
AGintronicDe novo--Yuen2017 G
CSMD1     AC02-1124-01chr8:
2944609-2944609
CAintronicDe novo--Kosmicki2017 E
Satterstrom2020 E
CSMD1     AU1909304chr8:
4676548-4676548
ATintronicDe novo--Yuen2017 G
CSMD1     5-0110-003chr8:
3488693-3488693
CGintronicDe novo--Yuen2017 G
CSMD1     5-0110-003chr8:
4668923-4668923
AGintronicDe novo--Yuen2017 G
CSMD1     09C85771chr8:
3565901-3565901
GCintronicDe novo--Kosmicki2017 E
Satterstrom2020 E
CSMD1     1-0820-003chr8:
3582022-3582022
TCintronicDe novo--Yuen2017 G
CSMD1     2-1702-004chr8:
5012511-5012511
TAintergenicDe novo--Yuen2017 G
CSMD1     7-0032-003chr8:
5160323-5160323
AGintergenicDe novo--Yuen2017 G
CSMD1     SSC12117chr8:
3046533-3046533
ATexonicDe novononsynonymous SNVNM_033225c.T5399Ap.V1800E16.27-Lim2017 E
CSMD1     2-1632-003chr8:
3596549-3596555
CTTTTTTCTTTTTTTintronicDe novo--Yuen2017 G
CSMD1     7-0032-003chr8:
5173485-5173485
TCintergenicDe novo--Yuen2017 G
CSMD1     SSC07229chr8:
2965314-2965314
TCexonicDe novononsynonymous SNVNM_033225c.A6761Gp.Q2254R1.421-Lim2017 E
CSMD1     2-1632-003chr8:
3301344-3301344
TAintronicDe novo--Yuen2017 G
CSMD1     7-0032-003chr8:
5186409-5186409
GTintergenicDe novo--Yuen2017 G
CSMD1     7-0032-003chr8:
5190906-5190906
GCintergenicDe novo--Yuen2017 G
CSMD1     SSC10416chr8:
3057267-3057267
GCexonicDe novosynonymous SNVNM_033225c.C5163Gp.A1721A1.075-Lim2017 E
CSMD1     2-1242-003chr8:
3504685-3504685
GTintronicDe novo--Yuen2016 G
Yuen2017 G
CSMD1     7-0032-003chr8:
5194798-5194798
GTintergenicDe novo--Yuen2017 G
CSMD1     7-0032-003chr8:
5218011-5218011
GAintergenicDe novo--Yuen2017 G
CSMD1     AU2951302chr8:
3479010-3479010
CTintronicDe novo--Yuen2017 G
CSMD1     AU3636302chr8:
4051589-4051589
AGintronicDe novo--Yuen2017 G
CSMD1     AU3636302chr8:
5829371-5829371
CTintergenicDe novo--Yuen2017 G
CSMD1     AU0636303chr8:
3886111-3886111
AGintronicDe novo--Yuen2017 G
CSMD1     7-0127-003chr8:
4673903-4673904
TGTintronicDe novo--Yuen2017 G
CSMD1     AU073003chr8:
3938917-3938917
AGintronicDe novo--Yuen2017 G
CSMD1     2-0057-004chr8:
4538125-4538127
CAGCintronicDe novo--Yuen2017 G
CSMD1     11006.p1chr8:
4612335-4612335
CTintronicDe novo--Werling2018 G
CSMD1     7-0250-003chr8:
4049981-4049981
ATintronicDe novo--Yuen2017 G
CSMD1     1-0296-004chr8:
3450600-3450600
TCintronicDe novo--Yuen2017 G
CSMD1     2-0036-003chr8:
5305145-5305145
AGintergenicDe novo--Yuen2016 G
CSMD1     2-1264-003chr8:
2933131-2933131
CGintronicDe novo--Yuen2017 G
CSMD1     1-0591-003chr8:
5172832-5172832
GAintergenicDe novo--Yuen2017 G
CSMD1     2-1346-003chr8:
2989867-2989867
TCintronicDe novo--Yuen2016 G
Yuen2017 G
CSMD1     5-0025-004chr8:
5011735-5011735
GGAintergenicDe novo--Yuen2017 G
CSMD1     AU070703chr8:
5792088-5792088
GCintergenicDe novo--Yuen2017 G
CSMD1     AU070703chr8:
5837519-5837519
GCintergenicDe novo--Yuen2017 G
CSMD1     2-0295-003chr8:
3840942-3840942
GAintronicDe novo--Yuen2017 G