or
or
Exact

Results for "RORB"

Variant Events: 21

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
RORB     AU076808chr9:
77275720-77275720
CGintronicDe novo--Yuen2017 G
RORB     364-05-104982chr9:
77286707-77286707
CTexonicDe novostopgainNM_006914c.C1114Tp.R372X37.0-Satterstrom2020 E
RORB     AU3907302chr9:
77302516-77302516
TAdownstreamDe novo--Yuen2017 G
RORB     2-0129-004chr9:
77257148-77257148
TCintronicDe novo--Yuen2017 G
RORB     2-1261-004chr9:
77297930-77297930
CTintronicDe novo--Yuen2017 G
RORB     Mahjani2021:141chr9:
77280437-77280437
GAexonicnonsynonymous SNVNM_006914c.G926Ap.R309H35.0-Mahjani2021 E
RORB     1-0304-003chr9:
77296915-77296915
ACintronicDe novo--Yuen2016 G
Yuen2017 G
RORB     2-0320-003chr9:
77234426-77234426
GAintronicDe novo--Yuen2017 G
RORB     1-0534-006chr9:
77326132-77326132
TCintergenicDe novo--Yuen2017 G
RORB     1-0572-003chr9:
77206859-77206892
TGAGAGAGAGAGAGACAGAGAGAGAGAGAGAGAGTGAGAGAGAGAGACAGAGAGAGAGAGAGAGAGintronicDe novo--Yuen2017 G
RORB     14314.p1chr9:
77245254-77245254
TGexonicDe novononsynonymous SNVNM_006914c.T64Gp.Y22D24.6-Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Krupp2017 E
Satterstrom2020 E
RORB     SSC11871chr9:
77245254-77245254
TGexonicDe novononsynonymous SNVNM_006914c.T64Gp.Y22D24.6-Lim2017 E
RORB     1-0289-004chr9:
77286498-77286498
GCintronicDe novo--Yuen2017 G
RORB     AU3727303chr9:
77324788-77324788
CTintergenicDe novo--Yuen2017 G
RORB     AU4153301chr9:
77311351-77311351
CTintergenicDe novo--Yuen2017 G
RORB     1-0446-003chr9:
77266886-77266886
CTintronicDe novo--Yuen2017 G
RORB     AU4154303chr9:
77331195-77331195
TGintergenicDe novo--Yuen2017 G
RORB     ASC_CA_63_Achr9:
77277445-77277445
AACGexonicDe novoframeshift insertionNM_006914c.815_816insCGp.Y272fs--Satterstrom2020 E
RORB     AU026604chr9:
77333365-77333365
CTintergenicDe novo--Yuen2017 G
RORB     2-0057-004chr9:
77304005-77304005
CTintergenicDe novo--Yuen2017 G
RORB     Mahjani2021:136chr9:
77277517-77277517
AGexonicnonsynonymous SNVNM_006914c.A887Gp.K296R25.8-Mahjani2021 E
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More