or
or
Exact

Results for "LRP1B"

Variant Events: 118

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
LRP1B     AU2108302chr2:
143074981-143074981
GAintergenicDe novo--Yuen2017 G
LRP1B     AU008505chr2:
141456328-141456328
TCintronicDe novo--Yuen2017 G
LRP1B     AU4024303chr2:
142771139-142771139
ATintronicDe novo--Yuen2017 G
LRP1B     A18chr2:
142586519-142586519
CTintronicDe novo--Wu2018 G
LRP1B     AU4150301chr2:
142917727-142917727
ATintergenicDe novo--Yuen2017 G
LRP1B     P1225chr2:
141609318-141609318
GAexonicDe novosynonymous SNVNM_018557c.C4614Tp.G1538G--Hashimoto2016 E
LRP1B     12026.p1chr2:
141812731-141812731
GAexonicMosaic Mat.synonymous SNVNM_018557c.C1506Tp.R502R--Dou2017 E
LRP1B     A18chr2:
142588059-142588059
CTintronicDe novo--Wu2018 G
LRP1B     2-0012-004chr2:
141348790-141348790
CTintronicDe novo--Yuen2017 G
LRP1B     A26chr2:
143620099-143620099
CTintergenicDe novo--Wu2018 G
LRP1B     AU4186302chr2:
142301941-142301942
TCTintronicDe novo--Yuen2017 G
LRP1B     AU4173301chr2:
142522503-142522503
AGintronicDe novo--Yuen2017 G
LRP1B     AU3782302chr2:
142845319-142845319
CAintronicDe novo--Yuen2017 G
LRP1B     1-0125-003chr2:
142476674-142476674
AGintronicDe novo--Yuen2017 G
LRP1B     1-0382-003chr2:
141887153-141887153
CTintronicDe novo--Yuen2017 G
LRP1B     AU3811305chr2:
141494052-141494052
CTintronicDe novo--Yuen2017 G
LRP1B     14496.p1chr2:
141554177-141554177
AGintronicDe novo--Turner2016 G
LRP1B     1-0299-004chr2:
142903744-142903744
ACintergenicDe novo--Yuen2017 G
LRP1B     1-0530-003chr2:
141424599-141424599
GTintronicDe novo--Yuen2016 G
Yuen2017 G
LRP1B     11002.p1chr2:
142233324-142233324
CTintronicDe novo--Turner2016 G
LRP1B     11002.p1chr2:
143121720-143121720
ACintergenicDe novo--Turner2016 G
LRP1B     AU017304chr2:
143498840-143498840
CTintergenicDe novo--Yuen2017 G
LRP1B     1-0636-003chr2:
141151222-141151246
CAATAAATAAATAAATAAATAAATACAATAAATAAATAAATAAATAintronicDe novo--Yuen2017 G
LRP1B     2-1112-003chr2:
142484307-142484307
ATintronicDe novo--Yuen2017 G
LRP1B     AU058105chr2:
143217723-143217723
GCintergenicDe novo--Yuen2017 G
LRP1B     2-1212-003chr2:
141206250-141206250
TCintronicDe novo--Yuen2017 G
LRP1B     1-0935-003chr2:
143170737-143170737
AGintergenicDe novo--Yuen2017 G
LRP1B     5-0003-003chr2:
142713334-142713334
CAintronicDe novo--Yuen2017 G
LRP1B     2-1454-003chr2:
141598094-141598094
AGintronicDe novo--Yuen2017 G
LRP1B     1-0554-003chr2:
143574202-143574202
TGintergenicDe novo--Yuen2017 G
LRP1B     2-1620-003chr2:
142906135-142906135
GCintergenicDe novo--Yuen2017 G
LRP1B     1-0277-003chr2:
141928045-141928045
GCintronicDe novo--Yuen2016 G
Yuen2017 G
LRP1B     AU4231301chr2:
142996126-142996126
GTintergenicDe novo--Yuen2017 G
LRP1B     AU3900302chr2:
142379652-142379652
GTintronicDe novo--Yuen2017 G
LRP1B     AU4372309chr2:
141080488-141080488
AGintronicDe novo--Yuen2017 G
LRP1B     AU1542301chr2:
142825401-142825401
TCintronicDe novo--Yuen2017 G
LRP1B     11977.p1chr2:
141093437-141093437
TCintronicDe novo--Satterstrom2020 E
LRP1B     AU000704chr2:
142960194-142960194
TGintergenicDe novo--Yuen2017 G
LRP1B     AU031404chr2:
142447213-142447214
CACintronicDe novo--Yuen2017 G
LRP1B     2-0057-004chr2:
142171641-142171641
CTintronicDe novo--Yuen2017 G
LRP1B     AU3645301chr2:
143459816-143459816
TCintergenicDe novo--Yuen2017 G
LRP1B     AU2988303chr2:
143595487-143595487
CTintergenicDe novo--Yuen2017 G
LRP1B     AU3125301chr2:
142465368-142465368
GAintronicDe novo--Yuen2017 G
LRP1B     1-0274-004chr2:
142034294-142034294
TCintronicDe novo--Yuen2017 G
LRP1B     7-0127-003chr2:
141266555-141266555
GAintronicDe novo--Yuen2017 G
LRP1B     5-0055-004chr2:
141989223-141989223
AGintronicDe novo--Yuen2017 G
LRP1B     2-1169-003chr2:
141266418-141266418
CGintronicDe novo--Yuen2017 G
LRP1B     5-0055-004chr2:
142576307-142576307
GAintronicDe novo--Yuen2017 G
LRP1B     5-0018-003chr2:
141245224-141245224
GAexonicDe novononsynonymous SNVNM_018557c.C9205Tp.R3069C20.11.655E-5Yuen2017 G
LRP1B     AU3912302chr2:
142367828-142367829
TATAAintronicDe novo--Yuen2017 G
LRP1B     1-0918-003chr2:
141779257-141779261
CTTTTCTTintronicDe novo--Yuen2017 G
LRP1B     5-0128-003chr2:
142694528-142694528
GCintronicDe novo--Yuen2017 G
LRP1B     AU055004chr2:
141585465-141585477
GAGCTCCAATTCAGAintronicDe novo--Yuen2017 G
LRP1B     1-0485-003chr2:
142808222-142808222
AGintronicDe novo--Yuen2017 G
LRP1B     1-0161-003chr2:
143620700-143620700
TCintergenicDe novo--Yuen2017 G
LRP1B     2-1461-003chr2:
142245141-142245141
TCintronicDe novo--Yuen2016 G
Yuen2017 G
LRP1B     1-0559-004chr2:
143559865-143559865
GGATintergenicDe novo--Yuen2017 G
LRP1B     2-1251-003chr2:
141449882-141449882
TCintronicDe novo--Yuen2017 G
LRP1B     5-0050-003chr2:
141742359-141742364
GTTCTAGintronicDe novo--Yuen2017 G
LRP1B     AU4027306chr2:
141057459-141057459
CTintronicDe novo--Yuen2017 G
LRP1B     AU3857301chr2:
141737197-141737197
GAintronicDe novo--Yuen2017 G
LRP1B     1-0373-003chr2:
143270155-143270155
GAintergenicDe novo--Yuen2017 G
LRP1B     2-0116-005chr2:
143198260-143198260
AGintergenicDe novo--Yuen2017 G
LRP1B     1-0300-003chr2:
141179957-141179957
AGintronicDe novo--Yuen2017 G
LRP1B     1-0572-003chr2:
142306767-142306767
TCintronicDe novo--Yuen2017 G
LRP1B     AU4188302chr2:
143283088-143283088
CTintergenicDe novo--Yuen2017 G
LRP1B     11459.p1chr2:
141291600-141291600
TCexonicMosaicsynonymous SNVNM_018557c.A7752Gp.L2584L--Dou2017 E
Krupp2017 E
LRP1B     AU3154301chr2:
142362935-142362935
GAintronicDe novo--Yuen2017 G
LRP1B     AU3634301chr2:
143545759-143545759
GAintergenicDe novo--Yuen2017 G
LRP1B     AU3057301chr2:
141876373-141876373
AGintronicDe novo--Yuen2017 G
LRP1B     1-0006-003chr2:
141779287-141779287
AATintronicDe novo--Yuen2017 G
LRP1B     AU1987302chr2:
141528712-141528712
GAintronicDe novo--Yuen2017 G
LRP1B     2-1480-003chr2:
141906763-141906764
TGTintronicDe novo--Yuen2017 G
LRP1B     2-1345-003chr2:
142163904-142163904
GAintronicDe novo--Yuen2016 G
Yuen2017 G
LRP1B     2-0208-004chr2:
141720134-141720134
GGCTCCTCTTCAGAintronicDe novo--Yuen2017 G
LRP1B     2-1146-003chr2:
141595275-141595275
CTintronicDe novo--Yuen2017 G
LRP1B     AU4273304chr2:
141567017-141567017
CTintronicDe novo--Yuen2017 G
LRP1B     1-0638-003chr2:
142270214-142270214
TCintronicDe novo--Yuen2017 G
LRP1B     2-0208-004chr2:
143237802-143237802
CTintergenicDe novo--Yuen2017 G
LRP1B     2-0182-003chr2:
142790627-142790627
CAintronicDe novo--Yuen2017 G
LRP1B     1-0210-004chr2:
141735636-141735636
TCintronicDe novo--Yuen2017 G
LRP1B     AU3610302chr2:
143364441-143364441
AGintergenicDe novo--Yuen2017 G
LRP1B     2-1338-003chr2:
143490534-143490534
CGintergenicDe novo--Yuen2017 G
LRP1B     2-1455-003chr2:
142278851-142278851
AGintronicDe novo--Yuen2016 G
LRP1B     2-1338-003chr2:
142880293-142880293
CTintronicDe novo--Yuen2017 G
LRP1B     2-1094-005chr2:
143020418-143020418
AGintergenicDe novo--Yuen2017 G
LRP1B     1-0656-003chr2:
143314582-143314582
GAintergenicDe novo--Yuen2017 G
LRP1B     1-0024-003chr2:
143407052-143407052
AGintergenicDe novo--Yuen2017 G
LRP1B     2-0704-003chr2:
142926730-142926730
CTintergenicDe novo--Yuen2016 G
Yuen2017 G
LRP1B     5-0129-003chr2:
143580017-143580017
ATintergenicDe novo--Yuen2017 G
LRP1B     1-0912-003chr2:
142127452-142127452
AGintronicDe novo--Yuen2017 G
LRP1B     AU060703chr2:
143413224-143413226
CATCintergenicDe novo--Yuen2017 G
LRP1B     PN400484chr2:
141812787-141812788
CTCexonicUnknownframeshift deletionNM_018557c.1449delAp.P483fs--Leblond2019 E
LRP1B     AU2495301chr2:
141652997-141652997
CTintronicDe novo--Yuen2017 G
LRP1B     AU3861301chr2:
142808393-142808393
ACintronicDe novo--Yuen2017 G
LRP1B     AU3779304chr2:
141208137-141208137
GAexonicDe novononsynonymous SNVNM_018557c.C10057Tp.P3353S28.82.478E-5Yuen2017 G
LRP1B     1-0139-003chr2:
142948743-142948743
GAintergenicDe novo--Yuen2017 G
LRP1B     1-0321-004chr2:
142946790-142946791
GCGintergenicDe novo--Yuen2017 G
LRP1B     AU4250301chr2:
141276433-141276433
CTintronicDe novo--Yuen2017 G
LRP1B     AU2793302chr2:
142038923-142038923
GCintronicDe novo--Yuen2017 G
LRP1B     1-0345-003chr2:
142946779-142946781
CCTCintergenicDe novo--Yuen2017 G
LRP1B     1-0991-003chr2:
141095206-141095206
GAintronicDe novo--Yuen2017 G
LRP1B     2-1178-003chr2:
143254109-143254109
CTintergenicDe novo--Yuen2016 G
Yuen2017 G
LRP1B     1-0518-003chr2:
141587070-141587070
TAintronicDe novo--Yuen2017 G
LRP1B     1-0383-003chr2:
141848980-141848980
CGintronicDe novo--Yuen2017 G
LRP1B     A32chr2:
142409188-142409188
CTintronicDe novo--Wu2018 G
LRP1B     1-0274-003chr2:
142034294-142034294
TCintronicDe novo--Yuen2017 G
LRP1B     7-0174-003chr2:
141092773-141092788
ATGTGTGTGTGTGTGTATGTGTGTGTGTGTintronicDe novo--Yuen2017 G
LRP1B     AU3790302chr2:
141676046-141676046
AGintronicDe novo--Yuen2017 G
LRP1B     1-0736-003chr2:
141966163-141966169
CGGGGGGCGGGGGGGintronicDe novo--Yuen2017 G
LRP1B     7-0129-003chr2:
141280649-141280649
CGintronicDe novo--Yuen2017 G
LRP1B     08C75365chr2:
141083302-141083302
ACintronicDe novo-8.383E-6Satterstrom2020 E
LRP1B     7-0223-003chr2:
141616816-141616816
CAintronicDe novo--Yuen2017 G
LRP1B     1-0871-003chr2:
143104863-143104863
AGintergenicDe novo--Yuen2017 G
LRP1B     2-1635-004chr2:
143327651-143327651
ACintergenicDe novo--Yuen2017 G
LRP1B     2-0007-003chr2:
141283080-141283080
TAintronicDe novo--Yuen2017 G
LRP1B     2-1690-003chr2:
141632212-141632212
GTintronicDe novo--Yuen2017 G
LRP1B     2-1485-004chr2:
143619736-143619736
CAintergenicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More