or
or
Exact

Results for "ATP2B2"

Variant Events: 25

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
ATP2B2     12473.p1chr3:
10384596-10384596
CTexonicDe novosynonymous SNVNM_001683
NM_001001331
c.G2622A
c.G2757A
p.T874T
p.T919T
--Krupp2017 E
Satterstrom2020 E
ATP2B2     3-0307-000chr3:
10380424-10380424
CTintronicDe novo--Yuen2017 G
ATP2B2     1-0380-003chr3:
10530142-10530142
TCintronicDe novo--Yuen2017 G
ATP2B2     1-0539-003chr3:
10596093-10596093
CTintergenicDe novo--Yuen2017 G
ATP2B2     2-0198-005chr3:
10489508-10489508
TGintronicDe novo--Yuen2017 G
ATP2B2     DEASD_0149_001chr3:
10370499-10370499
TTAAAGCGexonicDe novononframeshift insertionNM_001683
NM_001001331
c.3595_3596insCGCTTT
c.3730_3731insCGCTTT
p.X1199delinsSLX
p.X1244delinsSLX
--Satterstrom2020 E
ATP2B2     AU4069301chr3:
10455265-10455265
CAintronicDe novo--Yuen2017 G
ATP2B2     1-0484-003chr3:
10407351-10407351
GGTTintronicDe novo--Yuen2017 G
ATP2B2     2-1066-004chr3:
10407486-10407486
AATGintronicDe novo--Yuen2017 G
ATP2B2     2-0171-003chr3:
10489261-10489261
AGintronicDe novo--Yuen2017 G
ATP2B2     2-1155-003chr3:
10404551-10404565
CATATATATATATATCATATATATATATintronicDe novo--Yuen2017 G
ATP2B2     AU4306302chr3:
10619641-10619641
CTintergenicDe novo--Yuen2017 G
ATP2B2     AU3703302chr3:
10385751-10385751
CTintronicDe novo--Yuen2017 G
ATP2B2     472-05-104142chr3:
10400378-10400378
TCexonicDe novosynonymous SNVNM_001683
NM_001001331
c.A1998G
c.A2133G
p.P666P
p.P711P
--Satterstrom2020 E
ATP2B2     JASD_Fam0161chr3:
10381972-10381972
CTexonicDe novostopgainNM_001683
NM_001001331
c.G3056A
c.G3191A
p.W1019X
p.W1064X
45.0-Takata2018 E
ATP2B2     JASD_Fam0257chr3:
10392130-10392130
GTexonicDe novostopgainNM_001683
NM_001001331
c.C2133A
c.C2268A
p.C711X
p.C756X
43.0-Takata2018 E
ATP2B2     AU2100302chr3:
10551865-10551865
TCintergenicDe novo--Yuen2017 G
ATP2B2     1-0200-004chr3:
10557704-10557704
GTintergenicDe novo--Yuen2017 G
ATP2B2     1-0269-003chr3:
10376740-10376740
GAintronicDe novo--Yuen2017 G
ATP2B2     1-0054-004chr3:
10429858-10429858
CTintronicDe novo--Yuen2017 G
ATP2B2     2-0198-004chr3:
10489508-10489508
TGintronicDe novo--Yuen2017 G
ATP2B2     NDAR_INVTT613RN2_wes1chr3:
10420113-10420113
GAintronicDe novo-0.0251Kosmicki2017 E
Satterstrom2020 E
ATP2B2     12853.p1chr3:
10387773-10387773
GAexonicDe novononsynonymous SNVNM_001683
NM_001001331
c.C2318T
c.C2453T
p.T773M
p.T818M
29.7-Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Krupp2017 E
Satterstrom2020 E
Wilfert2021 G
ATP2B2     2-1416-004chr3:
10407342-10407342
TTGTTTGTGTGintronicDe novo--Yuen2017 G
ATP2B2     2-0225-004chr3:
10373397-10373397
TTAintronicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More