or
or
Exact

Results for "MSH3"

Variant Events: 17

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
MSH3     1-0564-003chr5:
80152510-80152510
TGintronicDe novo--Yuen2017 G
MSH3     1-0296-003chr5:
80091324-80091324
CGintronicDe novo--Yuen2017 G
MSH3     1-0677-003chr5:
79986517-79986529
TTAAACATAAACATTAAACAintronicDe novo--Yuen2017 G
MSH3     12710.p1chr5:
80169078-80169078
GAexonicMosaicnonsynonymous SNVNM_002439c.G3274Ap.E1092K32.0-Krupp2017 E
MSH3     5-0033-004chr5:
80232560-80232560
AGintergenicDe novo--Yuen2017 G
MSH3     AU3807302chr5:
80027328-80027328
TGintronicDe novo--Yuen2017 G
MSH3     1-0233-004chr5:
80028251-80028251
CAintronicDe novo--Yuen2017 G
MSH3     5-0077-004chr5:
80118396-80118396
CGintronicDe novo--Yuen2017 G
MSH3     13938.p1chr5:
79974821-79974821
CTexonicDe novononsynonymous SNVNM_002439c.C1249Tp.R417W14.84.943E-5Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Krupp2017 E
Satterstrom2020 E
MSH3     AU062204chr5:
80008044-80008044
CTintronicDe novo--Yuen2017 G
MSH3     1-0141-003chr5:
79963905-79963905
GAintronicDe novo--Yuen2017 G
MSH3     AU4079302chr5:
80047859-80047859
TCintronicDe novo--Yuen2017 G
MSH3     2-1379-003chr5:
80214712-80214712
TCintergenicDe novo--Yuen2016 G
Yuen2017 G
MSH3     2-1430-003 Complex Event; expand row to view variants  De novo--Yuen2016 G
Yuen2017 G
MSH3     2-1116-003chr5:
80182514-80182521
TTATCTATTTATintergenicDe novo--Yuen2017 G
MSH3     11456.p1chr5:
80062826-80062826
CTintronicDe novo--Turner2016 G
MSH3     2-0129-005chr5:
80205769-80205769
AGintergenicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More