or
or
Exact

Results for "RPS6KC1"

Variant Events: 46

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
RPS6KC1     AU2072302chr1:
213710243-213710243
GAintergenicDe novo--Yuen2017 G
RPS6KC1     AU4269301chr1:
213547426-213547426
AGintergenicDe novo--Yuen2017 G
RPS6KC1     2-1738-003chr1:
213850704-213850704
GAintergenicDe novo--Yuen2017 G
RPS6KC1     AU059903chr1:
213972878-213972878
AGintergenicDe novo--Yuen2017 G
RPS6KC1     5-0014-003chr1:
213336325-213336325
GAintronicDe novo--Yuen2017 G
RPS6KC1     1-0046-003chr1:
213590731-213590731
CTintergenicDe novo--Yuen2016 G
Yuen2017 G
RPS6KC1     2-1620-004chr1:
213238911-213238911
CTintronicDe novo--Yuen2017 G
RPS6KC1     2-0318-003chr1:
213494493-213494493
CTintergenicDe novo--Yuen2017 G
RPS6KC1     2-1456-004chr1:
213253490-213253500
CCTCAGGTGATCintronicDe novo--Yuen2017 G
RPS6KC1     PN400565chr1:
213303075-213303076
TCTexonicUnknownframeshift deletionNM_001136138
NM_001287221
NM_012424
NM_001287218
NM_001287219
c.643delC
c.136delC
c.679delC
c.136delC
c.136delC
p.P215fs
p.P46fs
p.P227fs
p.P46fs
p.P46fs
--Leblond2019 E
RPS6KC1     2-1128-003chr1:
213596787-213596787
TCintergenicDe novo--Yuen2016 G
Yuen2017 G
RPS6KC1     2-1422-003chr1:
213448644-213448644
TCintergenicDe novo--Yuen2016 G
Yuen2017 G
RPS6KC1     1-0509-003chr1:
213909729-213909729
GAintergenicDe novo--Yuen2016 G
Yuen2017 G
RPS6KC1     2-0244-003chr1:
213394388-213394388
ACintronicDe novo--Yuen2017 G
RPS6KC1     1-0494-003Achr1:
213988441-213988441
GAintergenicDe novo--Yuen2017 G
RPS6KC1     MT_109chr1:
213415526-213415526
GCexonicMaternalnonsynonymous SNVNM_001287220
NM_001136138
NM_001287221
NM_001287218
NM_001287219
NM_012424
c.G1312C
c.G2671C
c.G2164C
c.G2071C
c.G2071C
c.G2707C
p.E438Q
p.E891Q
p.E722Q
p.E691Q
p.E691Q
p.E903Q
18.582.481E-5Toma2013 E
RPS6KC1     1-0918-003chr1:
213817584-213817584
GTintergenicDe novo--Yuen2017 G
RPS6KC1     5-0125-003chr1:
213368349-213368349
TCintronicDe novo--Yuen2017 G
RPS6KC1     AU3398301chr1:
213965617-213965617
CTintergenicDe novo--Yuen2017 G
RPS6KC1     2-1330-003chr1:
213834701-213834701
CTintergenicDe novo--Yuen2016 G
Yuen2017 G
RPS6KC1     1-0629-003chr1:
213766003-213766003
CTintergenicDe novo--Yuen2017 G
RPS6KC1     2-1398-003chr1:
213681210-213681210
ACintergenicDe novo--Yuen2017 G
RPS6KC1     5-0131-003chr1:
213623601-213623601
GTintergenicDe novo--Yuen2017 G
RPS6KC1     AU066404chr1:
213595521-213595521
CGintergenicDe novo--Yuen2017 G
RPS6KC1     1-0367-003chr1:
213988959-213988959
CTintergenicDe novo--Yuen2017 G
RPS6KC1     PN400564chr1:
213303075-213303076
TCTexonicUnknownframeshift deletionNM_001136138
NM_001287221
NM_012424
NM_001287218
NM_001287219
c.643delC
c.136delC
c.679delC
c.136delC
c.136delC
p.P215fs
p.P46fs
p.P227fs
p.P46fs
p.P46fs
--Leblond2019 E
RPS6KC1     AU003405chr1:
213691685-213691685
CTintergenicDe novo--Yuen2017 G
RPS6KC1     2-1325-003 Complex Event; expand row to view variants  De novo--Yuen2016 G
Yuen2017 G
RPS6KC1     1-0973-003chr1:
213284583-213284583
TCintronicDe novo--Yuen2017 G
RPS6KC1     2-1415-004chr1:
213382211-213382215
GTATAGintronicDe novo--Yuen2017 G
RPS6KC1     2-1132-003chr1:
213278264-213278264
TTTAintronicDe novo--Yuen2017 G
RPS6KC1     AU4496301chr1:
213420314-213420314
AGintronicDe novo--Yuen2017 G
RPS6KC1     2-1280-003chr1:
213894512-213894512
AGintergenicDe novo--Yuen2016 G
Yuen2017 G
RPS6KC1     2-1741-003chr1:
213871988-213872003
GTATATATATATATATGTATATATATATATATATintergenicDe novo--Yuen2017 G
RPS6KC1     1-0777-003chr1:
213614973-213614973
TCintergenicDe novo--Yuen2017 G
RPS6KC1     2-0019-004chr1:
213753992-213753992
ACintergenicDe novo--Yuen2017 G
RPS6KC1     AU3190305chr1:
213752641-213752641
TGintergenicDe novo--Yuen2017 G
RPS6KC1     AU011903chr1:
213396677-213396677
AGintronicDe novo--Yuen2017 G
RPS6KC1     2-1577-003chr1:
213820863-213820863
AGintergenicDe novo--Yuen2017 G
RPS6KC1     2-0307-004chr1:
213418638-213418638
GTintronicDe novo--Yuen2017 G
RPS6KC1     5-0041-003chr1:
213359065-213359065
CTintronicDe novo--Yuen2017 G
RPS6KC1     13446.p1chr1:
213302953-213302953
CAexonicMosaicnonsynonymous SNVNM_001136138
NM_001287221
NM_012424
NM_001287218
NM_001287219
c.C520A
c.C13A
c.C556A
c.C13A
c.C13A
p.Q174K
p.Q5K
p.Q186K
p.Q5K
p.Q5K
16.31-Krupp2017 E
RPS6KC1     5-0083-003chr1:
213370215-213370215
CTintronicDe novo--Yuen2017 G
RPS6KC1     1-0804-003chr1:
213498511-213498511
TGintergenicDe novo--Yuen2017 G
RPS6KC1     13515.p1chr1:
213524664-213524664
CTintergenicDe novo--Turner2016 G
RPS6KC1     2-1366-004chr1:
213684756-213684756
ACintergenicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More