or
or
Exact

Results for "SORCS1"

Variant Events: 69

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
SORCS1     1-0458-005chr10:
108692900-108692900
TCintronicDe novo--Yuen2017 G
SORCS1     2-0135-004chr10:
109171115-109171115
CTintergenicDe novo--Yuen2017 G
SORCS1     14151.p1chr10:
108389096-108389096
CTexonicDe novosynonymous SNVNM_001013031
NM_001206569
NM_001206570
NM_001206571
NM_001206572
NM_052918
c.G2526A
c.G2526A
c.G2526A
c.G2526A
c.G2526A
c.G2526A
p.A842A
p.A842A
p.A842A
p.A842A
p.A842A
p.A842A
-4.973E-5Iossifov2014 E
Kosmicki2017 E
Krupp2017 E
Satterstrom2020 E
SORCS1     5-0074-003chr10:
109281137-109281137
CTintergenicDe novo--Yuen2017 G
SORCS1     11000.p1chr10:
108447964-108447964
CTexonicDe novononsynonymous SNVNM_001013031
NM_001206569
NM_001206570
NM_001206571
NM_001206572
NM_052918
c.G1546A
c.G1546A
c.G1546A
c.G1546A
c.G1546A
c.G1546A
p.V516M
p.V516M
p.V516M
p.V516M
p.V516M
p.V516M
18.621.656E-5Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Sanders2012 E
Satterstrom2020 E
Wilfert2021 G
SORCS1     AU055004chr10:
108335241-108335241
TCUTR3De novo--Yuen2017 G
SORCS1     2-1169-003chr10:
109399125-109399125
TGintergenicDe novo--Yuen2017 G
SORCS1     AU3888302chr10:
108552747-108552747
TAintronicDe novo--Yuen2017 G
SORCS1     AU2485305chr10:
108749454-108749454
TGintronicDe novo--Yuen2017 G
SORCS1     2-1605-003chr10:
109243704-109243704
CCATintergenicDe novo--Yuen2017 G
SORCS1     7-0183-003chr10:
109021945-109021945
ACintergenicDe novo--Yuen2017 G
SORCS1     5-0018-003chr10:
108951572-108951572
ACintergenicDe novo--Yuen2017 G
SORCS1     7-0255-003chr10:
108800886-108800886
AGintronicDe novo--Yuen2017 G
SORCS1     AU3702307chr10:
109581427-109581427
TCintergenicDe novo--Yuen2017 G
SORCS1     AU1933302chr10:
108406337-108406337
CAintronicDe novo--Yuen2017 G
SORCS1     1-0158-003chr10:
108737564-108737564
CTintronicDe novo--Yuen2017 G
SORCS1     5-0114-003chr10:
108526288-108526288
CAintronicDe novo--Yuen2017 G
SORCS1     AU3764302chr10:
109340861-109340861
ATintergenicDe novo--Yuen2017 G
SORCS1     1-1000-003chr10:
109224205-109224205
AGintergenicDe novo--Yuen2017 G
SORCS1     5-0003-004chr10:
108753908-108753908
CTintronicDe novo--Yuen2017 G
SORCS1     1-1000-003chr10:
109224201-109224201
GAintergenicDe novo--Yuen2017 G
SORCS1     1-0533-003chr10:
109451298-109451303
CTTATTCintergenicDe novo--Yuen2017 G
SORCS1     AU4093302chr10:
109295321-109295321
TCintergenicDe novo--Yuen2017 G
SORCS1     SSC10801chr10:
108389096-108389096
CTexonicDe novosynonymous SNVNM_001013031
NM_001206569
NM_001206570
NM_001206571
NM_001206572
NM_052918
c.G2526A
c.G2526A
c.G2526A
c.G2526A
c.G2526A
c.G2526A
p.A842A
p.A842A
p.A842A
p.A842A
p.A842A
p.A842A
-4.973E-5Lim2017 E
SORCS1     1-0277-003chr10:
108962434-108962447
GCACACACACACACGCACACACACACintergenicDe novo--Yuen2017 G
SORCS1     1-0368-004chr10:
108824152-108824152
GAintronicDe novo--Yuen2017 G
SORCS1     1-0597-003chr10:
108570757-108570757
GAintronicDe novo--Yuen2017 G
SORCS1     AU066404chr10:
109086437-109086437
CGintergenicDe novo--Yuen2017 G
SORCS1     1-0196-005chr10:
108782275-108782275
GAintronicDe novo--Yuen2017 G
SORCS1     2-1526-003chr10:
108892774-108892774
GAintronicDe novo--Yuen2017 G
SORCS1     1-0435-003chr10:
109088526-109088526
GAintergenicDe novo--Yuen2017 G
SORCS1     7-0143-003chr10:
109023165-109023165
CTintergenicDe novo--Yuen2017 G
SORCS1     2-1066-004chr10:
109597132-109597132
AATTTATintergenicDe novo--Yuen2017 G
SORCS1     AU2293302chr10:
109067244-109067244
AGintergenicDe novo--Yuen2017 G
SORCS1     AU005214chr10:
108586570-108586570
CGintronicDe novo--Yuen2017 G
SORCS1     AU076508chr10:
109430238-109430238
GAintergenicDe novo--Yuen2017 G
SORCS1     1-0995-003chr10:
108513287-108513301
CAGAGAGAGAGAGAGCAGAGAGAGAGAGintronicDe novo--Yuen2017 G
SORCS1     AU065304chr10:
109532522-109532522
CTintergenicDe novo--Yuen2017 G
SORCS1     2-1721-003chr10:
109574427-109574427
TAintergenicDe novo--Yuen2017 G
SORCS1     2-1281-003chr10:
108815533-108815533
CTintronicDe novo--Yuen2017 G
SORCS1     7-0058-003chr10:
108342528-108342528
CTintronicDe novo--Yuen2017 G
SORCS1     2-0256-004chr10:
109615500-109615500
CTintergenicDe novo--Yuen2017 G
SORCS1     AU4186302chr10:
108588647-108588647
GAintronicDe novo--Yuen2017 G
SORCS1     7-0100-003chr10:
108546427-108546427
CTintronicDe novo--Yuen2017 G
SORCS1     AU3692302chr10:
109582006-109582006
TCintergenicDe novo--Yuen2017 G
SORCS1     7-0149-003chr10:
109597526-109597526
ATintergenicDe novo--Yuen2017 G
SORCS1     14637.p1chr10:
108649594-108649594
GCintronicDe novo--Turner2016 G
SORCS1     13515.p1chr10:
109132935-109132935
AGintergenicDe novo--Turner2016 G
SORCS1     1-0447-003chr10:
109074293-109074293
TCintergenicDe novo--Yuen2017 G
SORCS1     AU2495302chr10:
109378560-109378560
GCintergenicDe novo--Yuen2017 G
SORCS1     AU2777302chr10:
109347891-109347891
CTintergenicDe novo--Yuen2017 G
SORCS1     2-0022-005chr10:
108897020-108897020
GAintronicDe novo--Yuen2017 G
SORCS1     AU3808304chr10:
109440375-109440375
CTintergenicDe novo--Yuen2017 G
SORCS1     1-0656-003chr10:
108546842-108546842
CAintronicDe novo--Yuen2017 G
SORCS1     AU2000305chr10:
109000769-109000772
TAAATAAintergenicDe novo--Yuen2017 G
SORCS1     2-1066-003chr10:
109597132-109597132
AATTTATintergenicDe novo--Yuen2017 G
SORCS1     AU058105chr10:
108748688-108748688
ATintronicDe novo--Yuen2017 G
SORCS1     5-0041-003chr10:
109116655-109116655
AGintergenicDe novo--Yuen2017 G
SORCS1     1-0436-003 Complex Event; expand row to view variants  De novo--Yuen2016 G
Yuen2017 G
SORCS1     2-1186-003chr10:
109494752-109494769
GCATTATCATTATCATTAGCATTATCATTAintergenicDe novo--Yuen2017 G
SORCS1     AU3713301chr10:
108399715-108399715
GCintronicDe novo--Yuen2017 G
SORCS1     2-1328-003chr10:
109293798-109293799
CTCintergenicDe novo--Yuen2016 G
Yuen2017 G
SORCS1     2-1562-004chr10:
109033939-109033939
GTintergenicDe novo--Yuen2017 G
SORCS1     2-1272-003chr10:
108863052-108863052
CAintronicDe novo--Yuen2016 G
SORCS1     1-0559-005chr10:
108978006-108978006
TCintergenicDe novo--Yuen2017 G
SORCS1     1-0191-004chr10:
108403311-108403311
TCintronicDe novo--Yuen2017 G
SORCS1     2-0286-003chr10:
108536855-108536855
AGintronicDe novo--Yuen2017 G
SORCS1     2-1408-003chr10:
108931917-108931917
TCintergenicDe novo--Yuen2017 G
SORCS1     2-1215-003chr10:
109255019-109255019
CTintergenicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More