or
or
Exact

Results for "Zhang2023"

Variant Events: 10

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
PRKD1     Zhang2023:ASD0219chr14:
30396649-30396680
CCGCTGCGGCAGCTGCCGCCGCCACGGGCAGCCexonicDe novoframeshift deletionNM_002742c.39_69delp.L13fs--Zhang2023 G
NF1     Zhang2023:ASD0162chr17:
29679273-29679273
ATsplicingDe novosplicing22.7-Zhang2023 G
PTEN     Zhang2023:ASD0294chr10:
89711930-89711930
AAAexonicDe novoframeshift insertionNM_000314
NM_001304717
c.548dupA
c.1067dupA
p.K183fs
p.K356fs
--Zhang2023 G
SCN2A     Zhang2023:ASD0221chr2:
166165305-166165305
GAsplicingDe novosplicing17.27-Zhang2023 G
SCN2A     Zhang2023:ASD0063chr2:
166237705-166237707
GCTGexonicDe novoframeshift deletionNM_001040143
NM_001040142
NM_021007
c.4550_4551del
c.4550_4551del
c.4550_4551del
p.A1517fs
p.A1517fs
p.A1517fs
--Zhang2023 G
EP300     Zhang2023:ASD0061chr22:
41565576-41565576
TGexonicDe novostopgainNM_001429c.T4242Gp.Y1414X51.0-Zhang2023 G
SHANK3     Zhang2023:ASD0148chr22:
51169309-51169322
GGGCTGGGGGCGGGGexonicDe novoframeshift deletionNM_033517c.4724_4736delp.G1575fs--Zhang2023 G
ADNP     Zhang2023:ASD0134chr20:
49509095-49509095
TTTexonicDe novostopgainNM_001282532
NM_181442
NM_015339
NM_001282531
c.2156dupA
c.2156dupA
c.2156dupA
c.2156dupA
p.Y719_E720delinsX
p.Y719_E720delinsX
p.Y719_E720delinsX
p.Y719_E720delinsX
--Zhang2023 G
ASH1L     Zhang2023:ASD0046chr1:
155308087-155308088
GAGexonicDe novoframeshift deletionNM_018489c.8595delTp.S2865fs--Zhang2023 G
SCN2A     Zhang2023:ASD0326chr2:
166172167-166172167
CTexonicDe novostopgainNM_001040143
NM_001040142
NM_021007
c.C1570T
c.C1570T
c.C1570T
p.R524X
p.R524X
p.R524X
29.7-Zhang2023 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More