or
or
Exact

Results for "EYA2"

Variant Events: 43

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
EYA2     1-0210-004chr20:
45830076-45830076
TCintergenicDe novo--Yuen2017 G
EYA2     1-0488-003chr20:
45750010-45750010
GAintronicDe novo--Yuen2017 G
EYA2     1-0534-004chr20:
45794119-45794119
CTintronicDe novo--Trost2022 G
Yuen2017 G
EYA2     1-0139-005chr20:
45753386-45753386
TGintronicDe novo--Yuen2017 G
EYA2     1-0299-003chr20:
45672392-45672392
AGintronicDe novo--Trost2022 G
Yuen2017 G
EYA2     SP0062265chr20:
45801464-45801464
CTexonicDe novononsynonymous SNVNM_005244
NM_172110
c.C1147T
c.C1147T
p.R383C
p.R383C
33.08.274E-6Antaki2022 GE
Fu2022 E
Trost2022 G
Zhou2022 GE
EYA2     1-0972-003chr20:
45729327-45729327
CTintronicDe novo--Trost2022 G
Yuen2017 G
EYA2     MSSNG00061-003chr20:
45535328-45535328
CAintronicDe novo--Trost2022 G
EYA2     A12chr20:
45780906-45780906
GAintronicDe novo--Wu2018 G
EYA2     2-1245-003chr20:
45614847-45614847
CTintronicDe novo--Yuen2017 G
EYA2     AU4032307chr20:
45574299-45574299
TCintronicDe novo--Trost2022 G
Yuen2017 G
EYA2     2-1425-004chr20:
45636563-45636563
AATintronicDe novo--Trost2022 G
EYA2     2-0285-004chr20:
45636563-45636563
AATintronicDe novo--Trost2022 G
EYA2     2-1364-003chr20:
45779228-45779228
TCintronicDe novo--Yuen2017 G
EYA2     2-1425-004chr20:
45636560-45636560
CAintronicDe novo--Trost2022 G
EYA2     2-1245-003chr20:
45625291-45625291
CGintronicDe novo--Yuen2017 G
EYA2     1-0051-005chr20:
45615607-45615608
GTAAintronicDe novo--Trost2022 G
EYA2     1-1144-003chr20:
45595012-45595012
GAintronicDe novo--Trost2022 G
EYA2     1-0410-003chr20:
45579514-45579514
AGintronicDe novo--Trost2022 G
EYA2     2-1540-003chr20:
45555971-45555971
GAintronicDe novo--Trost2022 G
EYA2     MSSNG00245-003chr20:
45536494-45536494
CTintronicDe novo--Trost2022 G
EYA2     2-1437-004chr20:
45722090-45722090
GGTCCACCTTintronicDe novo--Trost2022 G
EYA2     2-1455-003chr20:
45667223-45667237
CTGTGTGTGTGTGTGCTGTGTGTGTGTGintronicDe novo--Yuen2017 G
EYA2     5-5071-003chr20:
45700498-45700498
GAintronicDe novo--Trost2022 G
EYA2     3-0668-000chr20:
45697797-45697797
TCintronicDe novo--Trost2022 G
EYA2     2-1109-004chr20:
45666015-45666020
GAGAATGintronicDe novo--Trost2022 G
EYA2     2-1811-003chr20:
45663392-45663392
TGintronicDe novo--Trost2022 G
EYA2     2-1352-003chr20:
45823968-45823968
CTintergenicDe novo--Yuen2016 G
Yuen2017 G
EYA2     3-0325-000chr20:
45655512-45655514
ACTAintronicDe novo--Trost2022 G
EYA2     7-0354-004chr20:
45644646-45644646
CTintronicDe novo--Trost2022 G
EYA2     2-0285-004chr20:
45636567-45636567
TCintronicDe novo--Trost2022 G
EYA2     2-0305-003chr20:
45780638-45780639
GAGintronicDe novo--Trost2022 G
Yuen2017 G
EYA2     MSSNG00124-003chr20:
45812279-45812279
GCintronicDe novo--Trost2022 G
EYA2     1-1004-003chr20:
45701500-45701500
TCintronicDe novo--Trost2022 G
Yuen2017 G
EYA2     60-1015chr20:
45644877-45644877
AGexonicInheritednonsynonymous SNVNM_005244
NM_172110
c.A356G
c.A356G
p.Y119C
p.Y119C
19.446.589E-5Patowary2019 E
EYA2     4-0062-003chr20:
45802577-45802577
GAintronicDe novo--Trost2022 G
EYA2     SP0245361chr20:
45801377-45801377
GAexonicDe novononsynonymous SNVNM_005244
NM_172110
c.G1060A
c.G1060A
p.G354S
p.G354S
25.93.341E-5Trost2022 G
EYA2     2-1089-004chr20:
45712800-45712800
GAintronicDe novo--Yuen2017 G
EYA2     MSSNG00257-004chr20:
45778369-45778369
GAintronicDe novo--Trost2022 G
EYA2     5-5175-003chr20:
45757392-45757392
AGintronicDe novo--Trost2022 G
EYA2     1-0357-003chr20:
45746227-45746237
CAGTTGGCGATCintronicDe novo--Trost2022 G
EYA2     AU1725306chr20:
45645863-45645863
CAintronicDe novo--Trost2022 G
Yuen2017 G
EYA2     AU1725306chr20:
45646168-45646168
CTintronicDe novo--Trost2022 G
Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More