or
or
Exact

Results for "OBSCN"

Variant Events: 63

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
OBSCN     iHART1901chr1:
228560587-228560587
GTexonicPaternalstopgainNM_001098623
NM_001271223
c.G22108T
c.G24979T
p.E7370X
p.E8327X
65.05.69E-5Ruzzo2019 G
OBSCN     iHART1454chr1:
228540764-228540764
GAsplicingPaternalsplicing13.43-Ruzzo2019 G
OBSCN     iHART2796chr1:
228509081-228509081
CTexonicPaternalstopgainNM_001098623
NM_052843
NM_001271223
c.C14539T
c.C14539T
c.C17410T
p.Q4847X
p.Q4847X
p.Q5804X
63.0-Ruzzo2019 G
OBSCN     3-0018-000chr1:
228504573-228504573
CGexonicDe novosynonymous SNVNM_001098623
NM_052843
NM_001271223
c.C13449G
c.C13449G
c.C16320G
p.T4483T
p.T4483T
p.T5440T
--Yuen2017 G
OBSCN     iHART3046chr1:
228554779-228554795
AGGGAGCGAGACATCCTAexonicMaternalframeshift deletionNM_001098623
NM_001271223
c.19532_19547del
c.22403_22418del
p.R6511fs
p.R7468fs
-3.632E-5Ruzzo2019 G
OBSCN     iHART3047chr1:
228554779-228554795
AGGGAGCGAGACATCCTAexonicMaternalframeshift deletionNM_001098623
NM_001271223
c.19532_19547del
c.22403_22418del
p.R6511fs
p.R7468fs
-3.632E-5Ruzzo2019 G
OBSCN     11888.p1chr1:
228555669-228555687
ACTGCCCCAGCCATGCACCAintronicDe novo--Satterstrom2020 E
OBSCN     1-0497-003chr1:
228411813-228411813
GAintronicDe novo--Yuen2017 G
OBSCN     2-1391-003chr1:
228491517-228491517
AGexonicDe novononsynonymous SNVNM_001271223c.A13880Gp.Y4627C9.266-Yuen2017 G
OBSCN     AU4286302chr1:
228461421-228461421
GAintronicDe novo-1.816E-5Yuen2017 G
OBSCN     DEASD_0066_001chr1:
228553743-228553743
TGintronicDe novo-5.0E-4Satterstrom2020 E
OBSCN     2-1299-003chr1:
228557824-228557824
CTintronicDe novo-2.54E-5Yuen2017 G
OBSCN     AU3761302chr1:
228534143-228534143
CAintronicDe novo--Yuen2017 G
OBSCN     EGAN00001101028chr1:
228553743-228553743
TGintronicDe novo-5.0E-4Satterstrom2020 E
OBSCN     179-08-109807chr1:
228558817-228558817
CTexonicDe novononsynonymous SNVNM_001098623
NM_001271223
c.C20338T
c.C23209T
p.R6780W
p.R7737W
15.481.0E-4Fu2022 E
Satterstrom2020 E
OBSCN     13757.p1chr1:
228505699-228505699
TGexonicDe novosynonymous SNVNM_001098623
NM_052843
NM_001271223
c.T13956G
c.T13956G
c.T16827G
p.G4652G
p.G4652G
p.G5609G
-3.0E-4Satterstrom2020 E
OBSCN     11226.p1chr1:
228434310-228434310
GAexonicDe novononsynonymous SNVNM_001098623
NM_052843
NM_001271223
c.G3839A
c.G3839A
c.G4115A
p.C1280Y
p.C1280Y
p.C1372Y
14.12-Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Satterstrom2020 E
OBSCN     13705.p1chr1:
228509724-228509724
GAexonicDe novononsynonymous SNVNM_001098623
NM_052843
NM_001271223
c.G15182A
c.G15182A
c.G18053A
p.R5061H
p.R5061H
p.R6018H
11.322.013E-5Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Satterstrom2020 E
OBSCN     14168.p1chr1:
228538569-228538569
GAexonicDe novo, Mosaicnonsynonymous SNVNM_001098623
NM_052843
NM_001271223
c.G18344A
c.G18344A
c.G21215A
p.R6115Q
p.R6115Q
p.R7072Q
23.12.512E-5Dou2017 E
Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Krupp2017 E
OBSCN     11397.p1chr1:
228548375-228548375
CTexonicDe novosynonymous SNVNM_052843c.C19782Tp.T6594T-9.37E-5Iossifov2014 E
Kosmicki2017 E
Satterstrom2020 E
Wilfert2021 G
OBSCN     SP0133844chr1:
228463768-228463768
GTintronicDe novo--Fu2022 E
OBSCN     SP0068929chr1:
228460954-228460954
CTintronicDe novo--Fu2022 E
OBSCN     3316_17auchr1:
228407385-228407385
CTintronicDe novo--Fu2022 E
OBSCN     SP0035152chr1:
228474831-228474831
GAintronicDe novo--Fu2022 E
OBSCN     Chen2017:97chr1:
228447223-228447223
AGexonicDe novononsynonymous SNVNM_001271223c.A4883Gp.K1628R14.64-Chen2017 E
OBSCN     SP0038407chr1:
228466803-228466804
CACintronicDe novo--Fu2022 E
OBSCN     SP0080400chr1:
228505670-228505670
CGexonicDe novononsynonymous SNVNM_001098623
NM_052843
NM_001271223
c.C13927G
c.C13927G
c.C16798G
p.L4643V
p.L4643V
p.L5600V
15.73-Fu2022 E
OBSCN     SP0046788chr1:
228564796-228564796
GAexonicDe novononsynonymous SNVNM_001098623
NM_001271223
c.G23083A
c.G25954A
p.G7695R
p.G8652R
15.145.921E-5Fu2022 E
OBSCN     SP0110413chr1:
228475825-228475825
CTexonicDe novononsynonymous SNVNM_001098623
NM_052843
NM_001271223
c.C9875T
c.C9875T
c.C11162T
p.T3292M
p.T3292M
p.T3721M
15.192.486E-5Fu2022 E
OBSCN     SP0033747chr1:
228563406-228563406
GAexonicDe novononsynonymous SNVNM_001098623
NM_001271223
c.G22667A
c.G25538A
p.R7556H
p.R8513H
16.752.605E-5Fu2022 E
OBSCN     SP0101498chr1:
228565031-228565031
CCGGACTGATintronicDe novo--Fu2022 E
OBSCN     SP0116535chr1:
228552612-228552612
CTintronicDe novo--Fu2022 E
OBSCN     SP0085357chr1:
228465566-228465566
TGintronicDe novo--Fu2022 E
OBSCN     SP0053884chr1:
228465372-228465372
GAintronicDe novo-1.101E-5Fu2022 E
OBSCN     SSC02395chr1:
228434310-228434310
GAexonicDe novononsynonymous SNVNM_001098623
NM_052843
NM_001271223
c.G3839A
c.G3839A
c.G4115A
p.C1280Y
p.C1280Y
p.C1372Y
14.12-Fu2022 E
Lim2017 E
OBSCN     SP0057074chr1:
228526125-228526125
CGintronicDe novo--Fu2022 E
OBSCN     10C104458chr1:
228434296-228434296
TGexonicDe novononsynonymous SNVNM_001098623
NM_052843
NM_001271223
c.T3825G
c.T3825G
c.T4101G
p.S1275R
p.S1275R
p.S1367R
6.1064.213E-5Lim2017 E
OBSCN     ASC_CA_129_Achr1:
228553893-228553893
CTintronicDe novo-8.421E-6Fu2022 E
Satterstrom2020 E
OBSCN     SP0066343chr1:
228487294-228487294
CTintronicDe novo--Fu2022 E
OBSCN     AU050910chr1:
228579473-228579473
GAintergenicDe novo--Yuen2017 G
OBSCN     SP0089153chr1:
228547912-228547912
CTexonicDe novononsynonymous SNVNM_052843c.C19319Tp.T6440M14.191.0E-4Fu2022 E
OBSCN     SP0082146chr1:
228538939-228538939
TGintronicDe novo--Fu2022 E
OBSCN     AU2072302chr1:
228525007-228525007
CTexonicDe novononsynonymous SNVNM_001098623
NM_052843
NM_001271223
c.C16723T
c.C16723T
c.C19594T
p.R5575C
p.R5575C
p.R6532C
15.088.688E-5Yuen2017 G
OBSCN     3A551chr1:
228559450-228559450
GCexonicDe novononsynonymous SNVNM_001098623
NM_001271223
c.G20971C
c.G23842C
p.G6991R
p.G7948R
11.56-Satterstrom2020 E
OBSCN     1-0413-003chr1:
228563025-228563025
CGintronicDe novo--Yuen2016 G
Yuen2017 G
OBSCN     07C70673chr1:
228525007-228525007
CTexonicDe novononsynonymous SNVNM_001098623
NM_052843
NM_001271223
c.C16723T
c.C16723T
c.C19594T
p.R5575C
p.R5575C
p.R6532C
15.088.688E-5Fu2022 E
Satterstrom2020 E
OBSCN     7-0100-004chr1:
228523967-228523967
GAexonicDe novosynonymous SNVNM_001098623
NM_052843
NM_001271223
c.G16533A
c.G16533A
c.G19404A
p.R5511R
p.R5511R
p.R6468R
8.45-Yuen2017 G
OBSCN     AU2129301chr1:
228443154-228443154
AGintronicDe novo--Yuen2017 G
OBSCN     P1190chr1:
228476583-228476583
GCexonicDe novononsynonymous SNVNM_001098623
NM_052843
NM_001271223
c.G10333C
c.G10333C
c.G11620C
p.V3445L
p.V3445L
p.V3874L
12.85-Hashimoto2016 E
OBSCN     12225.p1chr1:
228401952-228401952
GGCexonicDe novoframeshift insertionNM_001098623
NM_001271223
NM_052843
c.1336_1337insC
c.1336_1337insC
c.1336_1337insC
p.V446fs
p.V446fs
p.V446fs
--Satterstrom2020 E
OBSCN     08C76149chr1:
228482697-228482697
CTexonicDe novononsynonymous SNVNM_001098623
NM_052843
NM_001271223
c.C11612T
c.C11612T
c.C12899T
p.S3871L
p.S3871L
p.S4300L
15.92-Fu2022 E
OBSCN     A1443Bchr1:
228470919-228470919
AGexonicDe novononsynonymous SNVNM_001098623
NM_052843
NM_001271223
c.A8671G
c.A8671G
c.A9958G
p.K2891E
p.K2891E
p.K3320E
18.43-Fu2022 E
OBSCN     iHART2188chr1:
228486166-228486166
CTexonicPaternalstopgainNM_001271223c.C12958Tp.R4320X62.05.261E-5Ruzzo2019 G
OBSCN     iHART3290chr1:
228476026-228476026
GAsplicingPaternalsplicing13.413.402E-5Ruzzo2019 G
OBSCN     iHART2795chr1:
228509081-228509081
CTexonicPaternalstopgainNM_001098623
NM_052843
NM_001271223
c.C14539T
c.C14539T
c.C17410T
p.Q4847X
p.Q4847X
p.Q5804X
63.0-Ruzzo2019 G
OBSCN     12929.p1chr1:
228553400-228553400
CTintronicDe novo--Wilfert2021 G
OBSCN     iHART2186chr1:
228486166-228486166
CTexonicPaternalstopgainNM_001271223c.C12958Tp.R4320X62.05.261E-5Ruzzo2019 G
OBSCN     4906chr1:
228505699-228505699
TGexonicDe novosynonymous SNVNM_001098623
NM_052843
NM_001271223
c.T13956G
c.T13956G
c.T16827G
p.G4652G
p.G4652G
p.G5609G
-3.0E-4Fu2022 E
OBSCN     200675785_1082034430chr1:
228447223-228447223
AGexonicDe novononsynonymous SNVNM_001271223c.A4883Gp.K1628R14.64-Fu2022 E
OBSCN     iHART3291chr1:
228476026-228476026
GAsplicingPaternalsplicing13.413.402E-5Ruzzo2019 G
OBSCN     ASC_151533chr1:
228563883-228563883
ATintronicDe novo--Fu2022 E
OBSCN     iHART1490chr1:
228465550-228465550
CTexonicMaternalstopgainNM_001098623
NM_052843
NM_001271223
c.C6850T
c.C6850T
c.C8137T
p.R2284X
p.R2284X
p.R2713X
47.07.585E-5Ruzzo2019 G
OBSCN     08C71265chr1:
228527670-228527670
CTexonicDe novosynonymous SNVNM_001098623
NM_052843
NM_001271223
c.C17283T
c.C17283T
c.C20154T
p.C5761C
p.C5761C
p.C6718C
10.938.302E-6Fu2022 E
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More