or
or
Exact

Results for "FSTL5"

Variant Events: 125

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
FSTL5     2-1398-004chr4:
162735764-162735764
TAintronicDe novo--Trost2022 G
Yuen2017 G
FSTL5     2-1526-003chr4:
163755819-163755819
AGintergenicDe novo--Yuen2017 G
FSTL5     2-0007-003chr4:
162662439-162662439
TCintronicDe novo--Trost2022 G
Yuen2017 G
FSTL5     AU2248302chr4:
163744894-163744894
TAintergenicDe novo--Yuen2017 G
FSTL5     7-0192-003chr4:
162900469-162900471
TCATintronicDe novo--Yuen2017 G
FSTL5     AU3124304 Complex Event; expand row to view variants  De novo--Trost2022 G
Yuen2017 G
FSTL5     2-0270-004chr4:
163352674-163352674
CTintergenicDe novo--Yuen2017 G
FSTL5     2-1485-004chr4:
162810148-162810148
TCintronicDe novo--Yuen2017 G
FSTL5     5-0030-003chr4:
163447741-163447741
AGintergenicDe novo--Yuen2017 G
FSTL5     AU4186302 Complex Event; expand row to view variants  De novo--Trost2022 G
Yuen2017 G
FSTL5     2-1715-004chr4:
162724012-162724012
TCintronicDe novo--Trost2022 G
Yuen2017 G
FSTL5     3-0438-000chr4:
163760903-163760903
GCintergenicDe novo--Yuen2016 G
FSTL5     AU4465303chr4:
162553966-162553966
GTintronicDe novo--Trost2022 G
Yuen2017 G
FSTL5     1-0162-004chr4:
163251462-163251462
ACintergenicDe novo--Yuen2017 G
FSTL5     1-0299-004chr4:
163523173-163523173
TTATGAATTTACATATGAintergenicDe novo--Yuen2017 G
FSTL5     iHART2951chr4:
163032450-163032450
ATexonicMaternalstopgainNM_001128427
NM_001128428
NM_020116
c.T99A
c.T99A
c.T99A
p.Y33X
p.Y33X
p.Y33X
41.08.242E-6Ruzzo2019 G
FSTL5     1-0479-006chr4:
162433147-162433147
AGintronicDe novo--Trost2022 G
Yuen2017 G
FSTL5     2-0149-004chr4:
162350709-162350709
TCintronicDe novo--Trost2022 G
Yuen2017 G
FSTL5     2-0208-003chr4:
163806061-163806062
TATintergenicDe novo--Yuen2017 G
FSTL5     1-0674-004chr4:
163756223-163756223
TCintergenicDe novo--Yuen2017 G
FSTL5     1-0820-003chr4:
163883969-163883969
ATintergenicDe novo--Yuen2017 G
FSTL5     AU062204chr4:
163442282-163442282
CTintergenicDe novo--Yuen2017 G
FSTL5     AU3517301chr4:
163381671-163381671
CTintergenicDe novo--Yuen2017 G
FSTL5     1-0874-003chr4:
162806829-162806829
GCintronicDe novo--Trost2022 G
Yuen2017 G
FSTL5     1-0142-005chr4:
162910805-162910805
CTintronicDe novo--Trost2022 G
Yuen2017 G
FSTL5     AU1795303chr4:
163714891-163714891
GTintergenicDe novo--Yuen2017 G
FSTL5     AU1725302chr4:
162844549-162844549
CGintronicDe novo--Trost2022 G
Yuen2017 G
FSTL5     2-1399-003chr4:
163757199-163757199
GAintergenicDe novo--Yuen2017 G
FSTL5     11252.p1chr4:
162705870-162705870
CTintronicDe novo--Turner2016 G
FSTL5     2-1168-003chr4:
162432095-162432095
GAintronicDe novo--Yuen2016 G
Yuen2017 G
FSTL5     1-0344-003chr4:
163390117-163390117
GCintergenicDe novo--Yuen2017 G
FSTL5     AU3912302chr4:
162585274-162585274
CTintronicDe novo--Trost2022 G
Yuen2017 G
FSTL5     13393.p1chr4:
162722869-162722869
AGintronicDe novo--Turner2016 G
FSTL5     1-0303-003chr4:
163938003-163938003
GAintergenicDe novo--Yuen2017 G
FSTL5     AU3368302chr4:
163392367-163392367
TCintergenicDe novo--Yuen2017 G
FSTL5     11341.p1chr4:
162811089-162811089
AGintronicDe novo--Turner2016 G
FSTL5     1-0582-003chr4:
163481132-163481132
ATintergenicDe novo--Yuen2017 G
FSTL5     AU3263302chr4:
162578927-162578927
CTintronicDe novo--Yuen2017 G
FSTL5     2-1085-003chr4:
163867225-163867225
CAintergenicDe novo--Yuen2017 G
FSTL5     5-0025-004chr4:
162407865-162407865
GAintronicDe novo--Trost2022 G
Yuen2017 G
FSTL5     2-1169-003chr4:
163544133-163544133
CCTintergenicDe novo--Yuen2017 G
FSTL5     AU0452304chr4:
162696142-162696142
AGintronicDe novo--Trost2022 G
Yuen2017 G
FSTL5     2-1291-003chr4:
162886590-162886590
TCintronicDe novo--Trost2022 G
Yuen2016 G
Yuen2017 G
FSTL5     2-0006-003chr4:
163022181-163022181
GAintronicDe novo--Trost2022 G
Yuen2017 G
FSTL5     2-1005-003chr4:
163659047-163659047
GAintergenicDe novo--Yuen2017 G
FSTL5     A11chr4:
163694896-163694896
CGintergenicDe novo--Wu2018 G
FSTL5     AU3874301chr4:
163002555-163002555
CTintronicDe novo--Trost2022 G
Yuen2017 G
FSTL5     13878.p1chr4:
163244883-163244883
TGintergenicMosaic--Dou2017 E
FSTL5     5-0054-003chr4:
162645050-162645050
ACintronicDe novo--Yuen2017 G
FSTL5     Cukier2014:17302chr4:
162697058-162697058
CTexonicUnknownnonsynonymous SNVNM_001128427
NM_001128428
NM_020116
c.G575A
c.G575A
c.G578A
p.G192E
p.G192E
p.G193E
22.50.0152Cukier2014 E
FSTL5     2-1369-003chr4:
163278792-163278792
ATintergenicDe novo--Yuen2017 G
FSTL5     2-1258-004chr4:
162635506-162635506
CTintronicDe novo--Trost2022 G
Yuen2017 G
FSTL5     7-0078-003chr4:
163512686-163512686
TGintergenicDe novo--Yuen2017 G
FSTL5     2-1094-005chr4:
162420989-162420989
TTATATTAGCAAATTCTTAGGAATACintronicDe novo--Yuen2017 G
FSTL5     MSSNG00201-003chr4:
162475569-162475571
TAATintronicDe novo--Trost2022 G
FSTL5     2-1341-004chr4:
163292468-163292468
CTintergenicDe novo--Yuen2017 G
FSTL5     MT_19.3chr4:
162548688-162548688
TCintronicDe novo--Trost2022 G
FSTL5     AU055603chr4:
162469209-162469209
ACintronicDe novo--Trost2022 G
FSTL5     REACH000650chr4:
162471891-162471891
GAintronicDe novo--Trost2022 G
FSTL5     4-0040-003chr4:
162328843-162328845
TCCATAintronicDe novo--Trost2022 G
FSTL5     AU2508301chr4:
162348291-162348291
TCintronicDe novo--Trost2022 G
FSTL5     2-0003-003chr4:
162585299-162585299
CTintronicDe novo--Trost2022 G
Yuen2017 G
FSTL5     AU4012302chr4:
163881294-163881294
ACintergenicDe novo--Yuen2017 G
FSTL5     1-0840-003chr4:
162305836-162305836
GAUTR3De novo--Trost2022 G
FSTL5     1-0563-003chr4:
163297215-163297215
TTCATGintergenicDe novo--Yuen2017 G
FSTL5     MSSNG00344-004chr4:
162621697-162621697
TGintronicDe novo--Trost2022 G
FSTL5     2-1741-003chr4:
163524533-163524571
TTTGGACACATAATTGGACACATAATTGGACACATAATTTTTGGACACATAATTGGACACATAATTintergenicDe novo--Yuen2017 G
FSTL5     REACH000597chr4:
162624599-162624599
GAintronicDe novo--Trost2022 G
FSTL5     AU3712301chr4:
162366824-162366824
CTintronicDe novo--Trost2022 G
Yuen2017 G
FSTL5     4-0073-003chr4:
162591544-162591546
GACAATintronicDe novo--Trost2022 G
FSTL5     AU004403chr4:
162601373-162601373
TAintronicDe novo--Trost2022 G
FSTL5     7-0371-003chr4:
162590688-162590688
GAintronicDe novo--Trost2022 G
FSTL5     2-1183-003chr4:
163733048-163733048
CGintergenicDe novo--Yuen2017 G
FSTL5     4-0062-003chr4:
162591544-162591546
GACAATintronicDe novo--Trost2022 G
FSTL5     5-5071-003chr4:
162567950-162567950
CTintronicDe novo--Trost2022 G
FSTL5     7-0005-003chr4:
162569535-162569535
GAintronicDe novo--Trost2022 G
FSTL5     mAGRE2951chr4:
163032450-163032450
ATexonicMaternalstopgainNM_001128427
NM_001128428
NM_020116
c.T99A
c.T99A
c.T99A
p.Y33X
p.Y33X
p.Y33X
41.08.242E-6Cirnigliaro2023 G
FSTL5     2-0063-003chr4:
162358535-162358535
GAintronicDe novo--Trost2022 G
Yuen2017 G
FSTL5     MSSNG00433-003chr4:
162747729-162747729
GAintronicDe novo--Trost2022 G
FSTL5     AU4183301chr4:
162692669-162692669
CTintronicDe novo--Trost2022 G
Yuen2017 G
FSTL5     MSSNG00004-004chr4:
162781721-162781721
CTintronicDe novo--Trost2022 G
FSTL5     B5X9C-01chr4:
162734078-162734078
TAintronicDe novo--Trost2022 G
FSTL5     D4S2Z-01chr4:
162734078-162734078
TAintronicDe novo--Trost2022 G
FSTL5     3-0197-000chr4:
162692325-162692325
ATintronicDe novo--Trost2022 G
FSTL5     2-0270-003chr4:
163352674-163352674
CTintergenicDe novo--Yuen2017 G
FSTL5     REACH000627chr4:
162721843-162721843
ACintronicDe novo--Trost2022 G
FSTL5     5-5146-003chr4:
162632879-162632879
CTintronicDe novo--Trost2022 G
FSTL5     MT_70.3chr4:
162650388-162650388
TAintronicDe novo--Trost2022 G
FSTL5     2-0109-003chr4:
162926203-162926203
TCintronicDe novo--Trost2022 G
Yuen2017 G
FSTL5     MSSNG00369-003chr4:
162891098-162891098
GAintronicDe novo--Trost2022 G
FSTL5     1-0073-003chr4:
162791155-162791155
TCintronicDe novo--Trost2022 G
Yuen2017 G
FSTL5     4-0062-003chr4:
162916787-162916787
TAintronicDe novo--Trost2022 G
FSTL5     MSSNG00014-003chr4:
162847784-162847785
TGTintronicDe novo--Trost2022 G
FSTL5     3-0719-000chr4:
162888860-162888860
TAintronicDe novo--Trost2022 G
FSTL5     2-1485-003chr4:
162810148-162810148
TCintronicDe novo--Trost2022 G
FSTL5     1-0260-004chr4:
162844286-162844286
CTintronicDe novo--Trost2022 G
FSTL5     AU060703chr4:
163111974-163111974
CTintergenicDe novo--Yuen2017 G
FSTL5     MSSNG00066-003chr4:
162806174-162806174
CTintronicDe novo--Trost2022 G
FSTL5     2-1166-003chr4:
162876423-162876423
TCintronicDe novo--Trost2022 G
Yuen2016 G
Yuen2017 G
FSTL5     2-1817-003chr4:
162807196-162807196
GAintronicDe novo--Trost2022 G
FSTL5     AU071203chr4:
163898809-163898809
GTintergenicDe novo--Yuen2017 G
FSTL5     1044chr4:
163000005-163000005
ACintronicDe novo--Trost2022 G
FSTL5     2-1764-004chr4:
163009738-163009738
GAintronicDe novo--Trost2022 G
FSTL5     5-5035-003chr4:
162993104-162993105
ATAintronicDe novo--Trost2022 G
FSTL5     1-0201-005chr4:
162442777-162442777
GAintronicDe novo--Trost2022 G
Yuen2017 G
FSTL5     AU2442301chr4:
162939666-162939666
GAintronicDe novo--Trost2022 G
FSTL5     1-0753-003chr4:
162940887-162940887
GGTTintronicDe novo--Trost2022 G
FSTL5     1-0225-003chr4:
163427110-163427110
TGintergenicDe novo--Yuen2017 G
FSTL5     5-0071-003chr4:
163322852-163322852
TGintergenicDe novo--Yuen2017 G
FSTL5     MSSNG00125-003chr4:
162932658-162932658
TCintronicDe novo--Trost2022 G
FSTL5     1-0699-003chr4:
163011792-163011792
GAintronicDe novo--Trost2022 G
Yuen2017 G
FSTL5     AU071203chr4:
162642169-162642169
GAintronicDe novo--Trost2022 G
Yuen2017 G
FSTL5     REACH000668chr4:
162934874-162934874
TCintronicDe novo--Trost2022 G
FSTL5     1-0051-005chr4:
163438487-163438487
GTintergenicDe novo--Yuen2017 G
FSTL5     4-0062-003chr4:
163079143-163079143
GAintronicDe novo--Trost2022 G
FSTL5     3-0017-000chr4:
163010868-163010868
ACintronicDe novo--Trost2022 G
FSTL5     AU2756306chr4:
163028385-163028385
GTintronicDe novo--Trost2022 G
FSTL5     A29chr4:
163380121-163380121
TCintergenicDe novo--Wu2018 G
FSTL5     1-0806-003chr4:
162742516-162742516
GAintronicDe novo--Trost2022 G
Yuen2017 G
FSTL5     AU2793302chr4:
163020598-163020598
CAintronicDe novo--Trost2022 G
Yuen2017 G
FSTL5     5-0109-003chr4:
163409817-163409817
TCintergenicDe novo--Yuen2017 G
FSTL5     2-1422-003chr4:
163626559-163626559
GAintergenicDe novo--Yuen2016 G
Yuen2017 G
FSTL5     2-0289-003chr4:
162420989-162420989
TTATATTAGCAAATTCTTAGGAATACintronicDe novo--Yuen2017 G
FSTL5     AU4234302chr4:
162993184-162993184
TCintronicDe novo--Trost2022 G
Yuen2017 G
FSTL5     7-0095-004chr4:
162783236-162783237
GAGintronicDe novo--Trost2022 G
Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More