or
or
Exact

Results for "CFAP74"

Variant Events: 23

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
CFAP74     SP0010331chr1:
1873489-1873489
CTexonicDe novononsynonymous SNVNM_001304360c.G2593Ap.V865M25.29.885E-5Fu2022 E
CFAP74     SSC10456chr1:
1903407-1903407
GAintronicDe novo--Trost2022 G
CFAP74     1-0467-005chr1:
1899605-1899605
TTGAAGAATGAGTGAGTGAATGAAGintronicDe novo--Yuen2017 G
CFAP74     SP0016630chr1:
1886511-1886511
CAintronicDe novo--Fu2022 E
CFAP74     SP0009759chr1:
1886346-1886346
GAintronicDe novo--Fu2022 E
CFAP74     13013.p1chr1:
1911859-1911859
CTintronicPaternal--Wilfert2021 G
CFAP74     13570.p1chr1:
1854141-1854141
TCexonicDe novononsynonymous SNVNM_001304360c.A4705Gp.S1569G--Iossifov2014 E
Kosmicki2017 E
Satterstrom2020 E
CFAP74     13215.p1chr1:
1900192-1900192
CTexonicMosaicnonsynonymous SNVNM_001304360c.G1127Ap.R376K12.658.28E-6Krupp2017 E
CFAP74     SP0054682chr1:
1886511-1886511
CAintronicDe novo--Fu2022 E
CFAP74     13743.p1chr1:
1886352-1886352
CTintronicDe novo--Iossifov2014 E
Kosmicki2017 E
CFAP74     SP0079288chr1:
1888163-1888163
GAexonicDe novononsynonymous SNVNM_001304360c.C1912Tp.R638W14.725.177E-5Fu2022 E
CFAP74     13985.p1chr1:
1886352-1886352
CTintronicDe novo--Iossifov2014 E
Kosmicki2017 E
CFAP74     SP0048711chr1:
1887133-1887133
CTexonicDe novononsynonymous SNVNM_001304360c.G2173Ap.A725T1.171-Fu2022 E
CFAP74     14274.p1chr1:
1903407-1903407
GAintronicDe novo--Iossifov2014 E
Kosmicki2017 E
Satterstrom2020 E
CFAP74     SP0031329chr1:
1873430-1873430
CTintronicDe novo--Fu2022 E
CFAP74     SP0038530chr1:
1905486-1905486
GAexonicDe novononsynonymous SNVNM_001304360c.C652Tp.R218W15.271.0E-4Fu2022 E
CFAP74     12221.p1chr1:
1886352-1886352
CTintronicDe novo--Iossifov2012 E
Iossifov2014 E
Kosmicki2017 E
CFAP74     SSC08103chr1:
1854141-1854141
TCexonicDe novononsynonymous SNVNM_001304360c.A4705Gp.S1569G--Fu2022 E
Trost2022 G
CFAP74     SSC07063chr1:
1890629-1890629
CTexonicDe novononsynonymous SNVNM_001304360c.G1781Ap.G594E19.42-Fu2022 E
Trost2022 G
CFAP74     1-0675-003chr1:
1920628-1920628
GAintronicDe novo--Yuen2017 G
CFAP74     13096.p1chr1:
1890629-1890629
CTexonicDe novononsynonymous SNVNM_001304360c.G1781Ap.G594E19.42-Iossifov2012 E
Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Krupp2017 E
Satterstrom2020 E
CFAP74     G01-GEA-139-HIchr1:
1891538-1891538
GCintronicDe novo3.468-Satterstrom2020 E
Trost2022 G
CFAP74     AU4468301chr1:
1903827-1903827
CTintronicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More