or
or
Exact

Results for "C1orf21"

Variant Events: 23

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
C1orf21     11456.p1chr1:
184472202-184472202
AGintronicDe novo--Turner2016 G
C1orf21     7-0371-004chr1:
184453338-184453338
CCTTTGGGAGGCCAAGTAATCTTTGGGintronicDe novo--Trost2022 G
C1orf21     13964.p1chr1:
184542676-184542676
GAintronicDe novo--Turner2016 G
C1orf21     AU3806304chr1:
184438052-184438057
AAAAACAintronicDe novo--Trost2022 G
C1orf21     2-1283-003chr1:
184529188-184529188
CAintronicDe novo--Trost2022 G
Yuen2017 G
C1orf21     MSSNG00036-003Achr1:
184484770-184484770
TCintronicDe novo--Trost2022 G
C1orf21     2-1408-003chr1:
184569335-184569335
TCintronicDe novo--Trost2022 G
Yuen2017 G
C1orf21     2-1686-003chr1:
184461313-184461313
CTintronicDe novo--Trost2022 G
C1orf21     7-0457-004chr1:
184387952-184387952
GAintronicDe novo--Trost2022 G
C1orf21     13264.p1chr1:
184536611-184536611
TGintronicMosaic--Dou2017 E
C1orf21     MSSNG00395-003chr1:
184361358-184361358
CTintronicDe novo--Trost2022 G
C1orf21     3-0146-000chr1:
184410494-184410494
ATintronicDe novo--Trost2022 G
C1orf21     4-0010-003chr1:
184398127-184398127
TGintronicDe novo--Trost2022 G
C1orf21     7-0478-003chr1:
184513533-184513533
ACintronicDe novo--Trost2022 G
C1orf21     MSSNG00011-004chr1:
184509136-184509136
CAintronicDe novo--Trost2022 G
C1orf21     MSSNG00183-003chr1:
184544313-184544313
AGintronicDe novo--Trost2022 G
C1orf21     MT_181.4chr1:
184541259-184541259
GAintronicDe novo--Trost2022 G
C1orf21     2-0171-003chr1:
184377111-184377111
GCintronicDe novo--Trost2022 G
Yuen2017 G
C1orf21     2-1283-004chr1:
184529188-184529188
CAintronicDe novo--Yuen2017 G
C1orf21     AU030703chr1:
184478998-184478998
GAintronicDe novo--Trost2022 G
Yuen2017 G
C1orf21     2-0022-003chr1:
184555794-184555794
TCintronicDe novo--Yuen2017 G
C1orf21     1-0513-003chr1:
184383984-184383984
TCintronicDe novo--Trost2022 G
Yuen2016 G
Yuen2017 G
C1orf21     11152.p1chr1:
184539555-184539556
GCTTintronicDe novo--Wilfert2021 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More