or
or
Exact

Results for "CLMP"

Variant Events: 30

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
CLMP     SP0133149chr11:
122954313-122954313
TGintronicDe novo--Fu2022 E
CLMP     2-1184-003chr11:
123130774-123130774
GCintergenicDe novo--Yuen2016 G
Yuen2017 G
CLMP     AU073005chr11:
123115153-123115153
CGintergenicDe novo--Yuen2017 G
CLMP     1-0344-003chr11:
123151852-123151852
CAintergenicDe novo--Yuen2017 G
CLMP     2-0019-004chr11:
123231027-123231027
CTintergenicDe novo--Trost2022 G
Yuen2017 G
CLMP     SJD_10chr11:
122953914-122953914
GCexonicMaternalnonsynonymous SNVNM_024769c.C558Gp.D186E15.68-Toma2013 E
CLMP     1-0493-003chr11:
122969190-122969196
TCTCCCATintronicDe novo--Yuen2017 G
CLMP     7-0001-003chr11:
123119803-123119803
GAintergenicDe novo--Yuen2017 G
CLMP     AU3368303chr11:
123114348-123114348
AGintergenicDe novo--Yuen2017 G
CLMP     AU079104chr11:
123176363-123176363
CTintergenicDe novo--Yuen2017 G
CLMP     1-0144-004chr11:
122957747-122957747
AAAGTintronicDe novo--Trost2022 G
CLMP     12716.p1chr11:
123008376-123008376
ATintronicDe novo--Wilfert2021 G
CLMP     7-0198-003chr11:
122958421-122958423
AAACGGintronicDe novo--Trost2022 G
CLMP     1-0144-004chr11:
122957736-122957736
TAAACAGATAAATAAATAAAATAACACAAAAGTAintronicDe novo--Trost2022 G
CLMP     1-0144-004chr11:
122957741-122957741
AACTAAATintronicDe novo--Trost2022 G
CLMP     5-0014-004chr11:
122957604-122957604
AAATAACACintronicDe novo--Trost2022 G
CLMP     2-1132-003chr11:
122957604-122957604
AAATAACACintronicDe novo--Trost2022 G
CLMP     1-0373-003chr11:
123221538-123221538
CTintergenicDe novo--Yuen2017 G
CLMP     5-5046-003chr11:
123235121-123235121
GAintergenicDe novo--Trost2022 G
CLMP     1-0104-003chr11:
122964626-122964626
GCintronicDe novo--Trost2022 G
Yuen2017 G
CLMP     2-1366-004chr11:
122957747-122957747
AAAGTintronicDe novo--Trost2022 G
Yuen2017 G
CLMP     2-1644-004chr11:
123099776-123099776
GTintergenicDe novo--Yuen2017 G
CLMP     REACH000727chr11:
123040966-123040966
CGintronicDe novo--Trost2022 G
CLMP     2-1750-003chr11:
123230202-123230202
AGintergenicDe novo--Trost2022 G
CLMP     1-0695-003chr11:
122964452-122964452
CTintronicDe novo--Trost2022 G
CLMP     2-1132-003chr11:
123012042-123012042
GAintronicDe novo--Trost2022 G
CLMP     4-0077-003chr11:
122958484-122958485
ATGCintronicDe novo--Trost2022 G
CLMP     3-0005-000chr11:
122964421-122964421
GAintronicDe novo--Trost2022 G
CLMP     1-0158-012chr11:
122957604-122957604
AAATAACACintronicDe novo--Trost2022 G
Yuen2017 G
CLMP     AU1933301chr11:
122967809-122967809
CTintronicDe novo--Trost2022 G
Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More