or
or
Exact

Results for "TBX3"

Variant Events: 97

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
TBX3     1-0158-012chr12:
116279108-116279108
TCintergenicDe novo--Yuen2017 G
TBX3     1-0303-004chr12:
115035000-115035000
CTintergenicDe novo--Yuen2017 G
TBX3     1-0113-003chr12:
115982340-115982340
CTintergenicDe novo--Yuen2016 G
TBX3     5-0077-003chr12:
115494938-115494938
GAintergenicDe novo--Yuen2017 G
TBX3     1-0321-004chr12:
114895837-114895837
TTATTAAGCACintergenicDe novo--Yuen2017 G
TBX3     2-1505-003chr12:
116280094-116280094
TTGAGGCAintergenicDe novo--Yuen2017 G
TBX3     13946.p1chr12:
115972753-115972753
TCintergenicDe novo--Turner2016 G
TBX3     1-0579-003chr12:
116002087-116002087
TCintergenicDe novo--Yuen2017 G
TBX3     AU2988302chr12:
115913448-115913448
CTintergenicDe novo--Yuen2017 G
TBX3     1-0208-003chr12:
115153694-115153694
AGintergenicDe novo--Yuen2017 G
TBX3     1-0368-004chr12:
115347134-115347134
GCintergenicDe novo--Yuen2017 G
TBX3     2-1425-004chr12:
115399518-115399542
TTCCATTATCCCACCTGGCAGCTGCTintergenicDe novo--Yuen2017 G
TBX3     AU1687302chr12:
115727326-115727326
ATintergenicDe novo--Yuen2017 G
TBX3     2-1066-004chr12:
114853546-114853546
CTintergenicDe novo--Yuen2017 G
TBX3     1-0484-003chr12:
115400420-115400432
CAAAGTGATTCTTCintergenicDe novo--Yuen2017 G
TBX3     2-1168-003chr12:
114874840-114874840
AGintergenicDe novo--Yuen2016 G
Yuen2017 G
TBX3     AU2569303chr12:
116358477-116358477
AGintergenicDe novo--Yuen2017 G
TBX3     7-0167-003chr12:
114908730-114908730
GCintergenicDe novo--Yuen2017 G
TBX3     1-0559-003chr12:
115593715-115593715
AGintergenicDe novo--Yuen2017 G
TBX3     1-0160-004chr12:
115314783-115314783
TCintergenicDe novo--Yuen2017 G
TBX3     1-0233-004chr12:
115890094-115890096
AGTAintergenicDe novo--Yuen2017 G
TBX3     2-1250-003chr12:
115124225-115124225
AAAGintergenicDe novo--Yuen2017 G
TBX3     2-1358-003chr12:
115802471-115802471
GAintergenicDe novo--Yuen2017 G
TBX3     2-1291-003chr12:
114897679-114897679
GAintergenicDe novo--Yuen2016 G
Yuen2017 G
TBX3     2-0068-003chr12:
115613786-115613794
GTGTGCGTAGintergenicDe novo--Yuen2017 G
TBX3     2-1505-004chr12:
116280094-116280094
TTGAGGCAintergenicDe novo--Yuen2017 G
TBX3     1-0214-003chr12:
115509019-115509019
CTintergenicDe novo--Yuen2017 G
TBX3     7-0160-003chr12:
115025819-115025819
AGintergenicDe novo--Yuen2017 G
TBX3     7-0160-003chr12:
116345457-116345457
AGintergenicDe novo--Yuen2017 G
TBX3     AU4243302chr12:
116340419-116340419
AGintergenicDe novo--Yuen2017 G
TBX3     AU3517301chr12:
115335751-115335751
GAintergenicDe novo--Yuen2017 G
TBX3     1-0052-003chr12:
116029275-116029275
ACintergenicDe novo--Yuen2017 G
TBX3     1-0052-003chr12:
115800462-115800462
GAintergenicDe novo--Yuen2017 G
TBX3     AU4067303chr12:
115267321-115267321
TCintergenicDe novo--Yuen2017 G
TBX3     1-0052-003chr12:
115222978-115222978
TGintergenicDe novo--Yuen2017 G
TBX3     2-1436-003chr12:
116077193-116077193
CTintergenicDe novo--Yuen2017 G
TBX3     AU4122301chr12:
115624663-115624663
AGintergenicDe novo--Yuen2017 G
TBX3     AU1940304chr12:
114947551-114947551
GAintergenicDe novo--Yuen2017 G
TBX3     1-0455-004chr12:
115895367-115895367
TGintergenicDe novo--Yuen2017 G
TBX3     AU4237304chr12:
115080560-115080560
GAintergenicDe novo--Yuen2017 G
TBX3     1-0142-005chr12:
114883470-114883470
CTintergenicDe novo--Yuen2017 G
TBX3     7-0188-003chr12:
115711259-115711259
GCintergenicDe novo--Yuen2017 G
TBX3     AU0039303chr12:
115051114-115051114
CAintergenicDe novo--Yuen2017 G
TBX3     AU2988303chr12:
115913448-115913448
CTintergenicDe novo--Yuen2017 G
TBX3     2-1365-003chr12:
115267305-115267305
CTintergenicDe novo--Yuen2017 G
TBX3     AU030804chr12:
115721707-115721707
CTintergenicDe novo--Yuen2017 G
TBX3     1-0206-004chr12:
115127228-115127228
GGAGCTGCAAGTTAintergenicDe novo--Yuen2017 G
TBX3     1-0453-003chr12:
115324320-115324320
TCintergenicDe novo--Yuen2017 G
TBX3     1-0582-003chr12:
115339602-115339602
GAintergenicDe novo--Yuen2017 G
TBX3     1-0756-005chr12:
116009769-116009769
AGintergenicDe novo--Yuen2017 G
TBX3     2-1155-003chr12:
115381689-115381689
AGintergenicDe novo--Yuen2016 G
Yuen2017 G
TBX3     2-1477-003chr12:
116184710-116184710
CTintergenicDe novo--Yuen2017 G
TBX3     AU3716302chr12:
115163096-115163096
TAintergenicDe novo--Yuen2017 G
TBX3     AU4343302chr12:
115063240-115063240
TCintergenicDe novo--Yuen2017 G
TBX3     2-1086-004chr12:
116358997-116358997
AGintergenicDe novo--Yuen2017 G
TBX3     AU4462302chr12:
115843850-115843850
GAintergenicDe novo--Yuen2017 G
TBX3     1-0022-004chr12:
115923461-115923474
GGTGTGTGTGTGTGGGTGTGTGTGTGintergenicDe novo--Yuen2017 G
TBX3     7-0106-003chr12:
115621036-115621036
CTintergenicDe novo--Yuen2017 G
TBX3     AU060403chr12:
115621375-115621375
GAintergenicDe novo--Yuen2017 G
TBX3     AU1687303chr12:
115727326-115727326
ATintergenicDe novo--Yuen2017 G
TBX3     2-1283-003chr12:
115677597-115677597
CGintergenicDe novo--Yuen2017 G
TBX3     AU4015302chr12:
115886573-115886573
AGintergenicDe novo--Yuen2017 G
TBX3     2-1182-003chr12:
115923461-115923474
GGTGTGTGTGTGTGGGTGTGTGTGTGintergenicDe novo--Yuen2017 G
TBX3     AU4013302chr12:
115376401-115376401
CTintergenicDe novo--Yuen2017 G
TBX3     A28chr12:
116058418-116058418
GAintergenicDe novo--Wu2018 G
TBX3     AU4079302chr12:
115123205-115123205
GAintergenicDe novo--Yuen2017 G
TBX3     3-0078-000chr12:
115109851-115109851
GTexonicDe novononsynonymous SNVNM_005996
NM_016569
c.C1967A
c.C2027A
p.A656D
p.A676D
10.5-Trost2022 G
Zhou2022 GE
TBX3     2-1359-003chr12:
116313697-116313697
CTintergenicDe novo--Yuen2017 G
TBX3     MT_25.3chr12:
115111457-115111457
CTintronicDe novo--Trost2022 G
TBX3     2-1577-003chr12:
115247112-115247112
GAintergenicDe novo--Yuen2017 G
TBX3     A12chr12:
116114170-116114170
GAintergenicDe novo--Wu2018 G
TBX3     AU4215302chr12:
115704306-115704310
ATTTTATTTTTintergenicDe novo--Yuen2017 G
TBX3     1-0835-003chr12:
116033981-116033981
GTintergenicDe novo--Yuen2017 G
TBX3     1-0826-003chr12:
116108146-116108146
AGintergenicDe novo--Yuen2017 G
TBX3     1-0289-004chr12:
116029309-116029309
GAintergenicDe novo--Yuen2017 G
TBX3     1-0289-004chr12:
115543523-115543523
CTintergenicDe novo--Yuen2017 G
TBX3     1-0059-003chr12:
114874523-114874523
GTintergenicDe novo--Yuen2017 G
TBX3     AU4286302chr12:
115321728-115321728
AGintergenicDe novo--Yuen2017 G
TBX3     1-0706-003chr12:
115011319-115011319
TCintergenicDe novo--Yuen2017 G
TBX3     13825.p1chr12:
115878431-115878431
GCintergenicDe novo--Wilfert2021 G
TBX3     2-1237-003chr12:
114928883-114928883
GCintergenicDe novo--Yuen2017 G
TBX3     AU3052303chr12:
116099437-116099437
AGintergenicDe novo--Yuen2017 G
TBX3     2-1153-003chr12:
115261200-115261200
TCintergenicDe novo--Yuen2016 G
Yuen2017 G
TBX3     7-0058-003chr12:
116177030-116177030
TCintergenicDe novo--Yuen2017 G
TBX3     2-1506-003chr12:
115065941-115065958
ATGTGTGTGTGTGTGTGTATGTGTGTGTGTGTGTintergenicDe novo--Yuen2017 G
TBX3     5-0088-003chr12:
115928452-115928452
GAintergenicDe novo--Yuen2017 G
TBX3     7-0166-003chr12:
115952179-115952179
AGintergenicDe novo--Yuen2017 G
TBX3     5-0026-003chr12:
115221899-115221899
TCintergenicDe novo--Yuen2017 G
TBX3     5-0026-003chr12:
116015889-116015891
AAGAintergenicDe novo--Yuen2017 G
TBX3     AU4237301chr12:
115585408-115585408
CGintergenicDe novo--Yuen2017 G
TBX3     2-1567-003chr12:
115342406-115342408
ATGAintergenicDe novo--Yuen2017 G
TBX3     2-0003-003chr12:
115165085-115165085
CTintergenicDe novo--Yuen2017 G
TBX3     5-0088-003chr12:
115291405-115291405
TCintergenicDe novo--Yuen2017 G
TBX3     2-1066-003chr12:
116212909-116212909
TCintergenicDe novo--Yuen2017 G
TBX3     2-1283-004chr12:
115677597-115677597
CGintergenicDe novo--Yuen2017 G
TBX3     1-0546-003chr12:
115709580-115709580
CTintergenicDe novo--Yuen2017 G
TBX3     1-0433-003chr12:
116362336-116362339
AGAGAintergenicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More