or
or
Exact

Results for "SPATA6"

Variant Events: 18

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
SPATA6     2-1461-003chr1:
48795262-48795262
CTintronicDe novo--Trost2022 G
Yuen2016 G
Yuen2017 G
SPATA6     5-0061-003chr1:
48995536-48995536
GAintergenicDe novo--Yuen2017 G
SPATA6     5-0014-003chr1:
48984036-48984036
CTintergenicDe novo--Yuen2017 G
SPATA6     13143.p1chr1:
48867296-48867296
CGintronicDe novo--Wilfert2021 G
SPATA6     2-1626-003chr1:
48948623-48948636
GTATATATATATATGTATATATATATintergenicDe novo--Yuen2017 G
SPATA6     A2chr1:
48822721-48822721
GCintronicDe novo--Wu2018 G
SPATA6     5-0018-003chr1:
48920456-48920456
AGintronicDe novo--Trost2022 G
Yuen2017 G
SPATA6     SP0097395chr1:
48771428-48771428
TGintronicDe novo--Fu2022 E
SPATA6     2-0159-003chr1:
48886330-48886330
GCintronicDe novo--Trost2022 G
SPATA6     5-0042-003chr1:
48870329-48870330
TATintronicDe novo--Trost2022 G
SPATA6     5-0109-003chr1:
48827020-48827020
AGintronicDe novo--Trost2022 G
Yuen2017 G
SPATA6     4-0073-003chr1:
48931744-48931745
TTAAintronicDe novo--Trost2022 G
SPATA6     2-1591-003chr1:
48893246-48893257
TAACCAATTAAATintronicDe novo--Trost2022 G
SPATA6     mAGRE5489chr1:
48877261-48877261
CAsplicingPaternalsplicing19.57-Cirnigliaro2023 G
SPATA6     3-0107-001chr1:
48815446-48815446
CTintronicDe novo--Trost2022 G
SPATA6     AU1860302chr1:
48895595-48895595
GAintronicDe novo--Trost2022 G
Yuen2017 G
SPATA6     MSSNG00056-003chr1:
48832953-48832956
GGGTGintronicDe novo--Trost2022 G
SPATA6     MSSNG00258-005chr1:
48829631-48829631
ACintronicDe novo--Trost2022 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More