or
or
Exact

Results for "NELL1"

Variant Events: 128

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
NELL1     MSSNG00332-003chr11:
21557166-21557166
TAintronicDe novo--Trost2022 G
NELL1     AU072504chr11:
20782546-20782546
GCintronicDe novo--Trost2022 G
Yuen2017 G
NELL1     AU2310301chr11:
21558484-21558484
ACintronicDe novo--Trost2022 G
NELL1     2-1823-003chr11:
21534738-21534738
CTintronicDe novo--Trost2022 G
NELL1     AUTPGX_1015chr11:
21534744-21534744
CAintronicDe novo--Trost2022 G
NELL1     MT_155.3chr11:
21481971-21481971
CGintronicDe novo--Trost2022 G
NELL1     AU_328chr11:
20691269-20691269
GCUTR5De novo--Fu2022 E
Satterstrom2020 E
Trost2022 G
NELL1     1-1120-003chr11:
21500871-21500871
GTintronicDe novo--Trost2022 G
NELL1     2-1818-003chr11:
21443793-21443793
AGintronicDe novo--Trost2022 G
NELL1     2-1497-003chr11:
21599496-21599512
AACACACACACACACACAACACACACACACACintergenicDe novo--Yuen2017 G
NELL1     AU2310301chr11:
21454213-21454213
CGintronicDe novo--Trost2022 G
NELL1     AU4056302chr11:
20765234-20765234
TGintronicDe novo--Trost2022 G
Yuen2017 G
NELL1     13539.p1chr11:
20703895-20703895
AGintronicDe novo--Turner2016 G
NELL1     AU061104chr11:
21110038-21110038
AGintronicDe novo--Trost2022 G
Yuen2017 G
NELL1     3-0050-000chr11:
21564689-21564689
AGintronicDe novo--Trost2022 G
NELL1     REACH000555chr11:
21578791-21578791
CGintronicDe novo--Trost2022 G
NELL1     AU1933302chr11:
21706969-21706969
CTintergenicDe novo--Yuen2017 G
NELL1     2-0297-004 Complex Event; expand row to view variants  De novo--Trost2022 G
Yuen2017 G
NELL1     AU4264302chr11:
20862865-20862865
GTintronicDe novo--Yuen2017 G
NELL1     AU4336301chr11:
21082095-21082095
GCintronicDe novo--Trost2022 G
Yuen2017 G
NELL1     2-0142-004chr11:
21071006-21071006
CGintronicDe novo--Trost2022 G
Yuen2017 G
NELL1     1-0377-003chr11:
21802080-21802080
GAintergenicDe novo--Yuen2017 G
NELL1     1-0144-005chr11:
21083789-21083789
TGintronicDe novo--Trost2022 G
Yuen2017 G
NELL1     AU2139301chr11:
21173871-21173871
GAintronicDe novo--Trost2022 G
Yuen2017 G
NELL1     AU3765303chr11:
22041156-22041156
CAintergenicDe novo--Yuen2017 G
NELL1     7-0135-003chr11:
21628195-21628195
GCintergenicDe novo--Yuen2017 G
NELL1     5-0064-003chr11:
21494311-21494311
CAintronicDe novo--Trost2022 G
Yuen2017 G
NELL1     AU4452302chr11:
22011593-22011593
GAintergenicDe novo--Yuen2017 G
NELL1     2-1715-004chr11:
21148441-21148446
TAAGTCTintronicDe novo--Trost2022 G
Yuen2017 G
NELL1     2-1507-003chr11:
21400075-21400076
TCTintronicDe novo--Yuen2017 G
NELL1     AU3724302chr11:
21402235-21402235
TCintronicDe novo--Trost2022 G
Yuen2017 G
NELL1     AU060004chr11:
21952567-21952567
AGintergenicDe novo--Yuen2017 G
NELL1     AU002903chr11:
21098443-21098443
TCintronicDe novo--Trost2022 G
Yuen2017 G
NELL1     5-0050-004chr11:
21065045-21065045
CTintronicDe novo--Trost2022 G
Yuen2017 G
NELL1     1-0671-003chr11:
22212653-22212653
GCintergenicDe novo--Yuen2017 G
NELL1     2-1306-003chr11:
21510014-21510014
GCintronicDe novo--Trost2022 G
Yuen2017 G
NELL1     2-1549-003chr11:
21476089-21476089
AGintronicDe novo--Trost2022 G
Yuen2017 G
NELL1     AU4243302chr11:
20997903-20997903
CGintronicDe novo--Trost2022 G
Yuen2017 G
NELL1     5-0105-003chr11:
21849139-21849139
GCintergenicDe novo--Yuen2017 G
NELL1     2-0145-003chr11:
22141787-22141787
GCintergenicDe novo--Yuen2017 G
NELL1     AU4315302chr11:
21463016-21463016
CTintronicDe novo--Trost2022 G
Yuen2017 G
NELL1     2-0319-004chr11:
21383679-21383679
AACintronicDe novo--Yuen2017 G
NELL1     1-0466-003chr11:
21678347-21678347
CAintergenicDe novo--Yuen2017 G
NELL1     1-0652-004chr11:
21405732-21405732
CTintronicDe novo--Trost2022 G
Yuen2017 G
NELL1     AU012803chr11:
20999910-20999910
CAintronicDe novo--Trost2022 G
Yuen2017 G
NELL1     2-0081-003chr11:
21406247-21406247
GGTintronicDe novo--Yuen2017 G
NELL1     5-0041-003chr11:
21076540-21076540
ATintronicDe novo--Trost2022 G
Yuen2017 G
NELL1     1-0259-005chr11:
20794404-20794404
CTintronicDe novo--Trost2022 G
Yuen2017 G
NELL1     AU2029302chr11:
20997757-20997761
GATATGATintronicDe novo--Yuen2017 G
NELL1     2-1346-003 Complex Event; expand row to view variants  De novo--Yuen2016 G
Yuen2016 G
NELL1     2-1644-003chr11:
20934830-20934830
CGintronicDe novo--Trost2022 G
Yuen2017 G
NELL1     AU4060306chr11:
21855754-21855754
CGintergenicDe novo--Yuen2017 G
NELL1     2-1341-003chr11:
21791377-21791377
GAintergenicDe novo--Yuen2017 G
NELL1     2-1207-003chr11:
22023508-22023508
GAintergenicDe novo--Yuen2016 G
Yuen2017 G
NELL1     2-1114-003chr11:
21866141-21866141
GTintergenicDe novo--Yuen2017 G
NELL1     2-1426-003chr11:
21732542-21732542
GTintergenicDe novo--Yuen2017 G
NELL1     2-1315-003chr11:
21535028-21535028
AGintronicDe novo--Yuen2016 G
Yuen2017 G
NELL1     2-1318-004chr11:
21513521-21513521
TGintronicDe novo--Trost2022 G
Yuen2017 G
NELL1     2-1335-003chr11:
22022341-22022341
TGintergenicDe novo--Yuen2017 G
NELL1     2-1206-003chr11:
21810330-21810330
GCintergenicDe novo--Yuen2017 G
NELL1     G01_GEA530HIchr11:
21594636-21594636
TGintronicDe novo--Fu2022 E
NELL1     AU061003chr11:
20957925-20957929
GATCTGintronicDe novo--Trost2022 G
Yuen2017 G
NELL1     2-0244-003chr11:
22178519-22178519
TCintergenicDe novo--Yuen2017 G
NELL1     AU3859301chr11:
20982962-20982962
TCintronicDe novo--Trost2022 G
Yuen2017 G
NELL1     1-0007-003chr11:
21460565-21460565
CTintronicDe novo--Trost2022 G
Yuen2017 G
NELL1     1-0651-003chr11:
22135527-22135527
GTintergenicDe novo--Yuen2017 G
NELL1     AU3634301chr11:
21042434-21042434
ACintronicDe novo--Trost2022 G
Yuen2017 G
NELL1     1-0068-003chr11:
21091166-21091166
TCintronicDe novo--Trost2022 G
Yuen2017 G
NELL1     AU3517302chr11:
21051265-21051265
AGintronicDe novo--Yuen2017 G
NELL1     13606.p1chr11:
21883790-21883794
CTTACTTTATintergenicMaternal--Wilfert2021 G
NELL1     2-1188-003chr11:
21997979-21997979
CAintergenicDe novo--Yuen2017 G
NELL1     AU079204 Complex Event; expand row to view variants  De novo--Trost2022 G
Yuen2017 G
NELL1     AU038703chr11:
21334367-21334367
CAintronicDe novo--Trost2022 G
Yuen2017 G
NELL1     AU027506 Complex Event; expand row to view variants  De novo--Trost2022 G
Yuen2017 G
NELL1     1-0010-005chr11:
21488119-21488121
CTTCintronicDe novo--Trost2022 G
Yuen2017 G
NELL1     2-1306-004chr11:
21510014-21510014
GCintronicDe novo--Yuen2017 G
NELL1     AU4072303chr11:
21888388-21888388
CTintergenicDe novo--Yuen2017 G
NELL1     1-0323-004chr11:
21961809-21961809
GTintergenicDe novo--Yuen2017 G
NELL1     AU4072303chr11:
21896256-21896256
CGintergenicDe novo--Yuen2017 G
NELL1     AU2029303chr11:
20997757-20997761
GATATGATintronicDe novo--Yuen2017 G
NELL1     1-0638-003chr11:
21143021-21143021
CGintronicDe novo--Trost2022 G
Yuen2017 G
NELL1     2-1425-003chr11:
21750121-21750121
CTintergenicDe novo--Yuen2017 G
NELL1     2-1163-003chr11:
21195295-21195310
ATGTGTGTGTGTGTGTATGTGTGTGTGTGTintronicDe novo--Yuen2017 G
NELL1     AU005213chr11:
21550596-21550596
TCintronicDe novo--Trost2022 G
Yuen2017 G
NELL1     2-1508-004chr11:
21940670-21940670
GAintergenicDe novo--Yuen2017 G
NELL1     2-1308-003chr11:
21108086-21108086
TAintronicDe novo--Yuen2016 G
NELL1     3-0215-000chr11:
20799836-20799836
GAintronicDe novo--Trost2022 G
NELL1     AU2310301chr11:
20807362-20807362
AGintronicDe novo--Trost2022 G
NELL1     4-0095-003chr11:
20715520-20715520
TCintronicDe novo--Trost2022 G
NELL1     3-0774-000Achr11:
20750045-20750045
TAintronicDe novo--Trost2022 G
NELL1     MSSNG00196-003chr11:
20699133-20699133
GTintronicDe novo--Trost2022 G
NELL1     2-0238-004chr11:
20964156-20964156
CAintronicDe novo--Trost2022 G
Yuen2017 G
NELL1     MSSNG00361-003chr11:
20702225-20702225
AGintronicDe novo--Trost2022 G
NELL1     2-1179-003chr11:
20693632-20693632
GAintronicDe novo--Trost2022 G
NELL1     3-0833-000chr11:
20695043-20695043
GTintronicDe novo--Trost2022 G
NELL1     MSSNG00419-003chr11:
21059522-21059522
TGintronicDe novo--Trost2022 G
NELL1     MSSNG00342-004chr11:
21080193-21080193
TAintronicDe novo--Trost2022 G
NELL1     1-0121-003chr11:
21814956-21814956
CTintergenicDe novo--Yuen2017 G
NELL1     4-0046-003chr11:
20939215-20939216
ACAintronicDe novo--Trost2022 G
NELL1     2-1456-003chr11:
21462238-21462238
GTintronicDe novo--Trost2022 G
Yuen2017 G
NELL1     AU055603chr11:
21005501-21005501
AGintronicDe novo--Trost2022 G
NELL1     4-0062-003chr11:
20886795-20886796
TGATintronicDe novo--Trost2022 G
NELL1     2-1231-003chr11:
20963562-20963571
TCTTACTTACTCTTACintronicDe novo--Yuen2017 G
NELL1     AU4013303chr11:
20811099-20811099
CGintronicDe novo--Trost2022 G
Yuen2017 G
NELL1     MSSNG00001-004chr11:
20916537-20916537
GTintronicDe novo--Trost2022 G
NELL1     7-0454-003chr11:
20850291-20850291
GTintronicDe novo--Trost2022 G
NELL1     1-0853-003chr11:
20867868-20867868
CAintronicDe novo--Trost2022 G
NELL1     AU015903chr11:
21607782-21607782
TCintergenicDe novo--Yuen2017 G
NELL1     AU3881301chr11:
21469312-21469312
CAintronicDe novo--Trost2022 G
Yuen2017 G
NELL1     5-5004-003chr11:
21192261-21192261
AGintronicDe novo--Trost2022 G
NELL1     AU015903chr11:
21651116-21651116
GAintergenicDe novo--Yuen2017 G
NELL1     1033chr11:
21211443-21211443
GCintronicDe novo--Trost2022 G
NELL1     AU055603chr11:
21167726-21167726
GCintronicDe novo--Trost2022 G
NELL1     AU2320301chr11:
21174068-21174068
GTintronicDe novo--Trost2022 G
NELL1     MSSNG00029-004chr11:
21126867-21126867
GAintronicDe novo--Trost2022 G
NELL1     MSSNG00169-003chr11:
21144915-21144915
GAintronicDe novo--Trost2022 G
NELL1     REACH000705chr11:
21105105-21105105
GAintronicDe novo--Trost2022 G
NELL1     MSSNG00417-003chr11:
21123776-21123776
CTintronicDe novo--Trost2022 G
NELL1     7-0240-005chr11:
21422231-21422231
CTintronicDe novo--Trost2022 G
NELL1     7-0257-003chr11:
21433553-21433553
CGintronicDe novo--Trost2022 G
NELL1     AU2310301chr11:
21352120-21352120
TCintronicDe novo--Trost2022 G
NELL1     1-0303-004chr11:
21671965-21671965
TGintergenicDe novo--Yuen2017 G
NELL1     1-0649-003chr11:
21356334-21356334
GCintronicDe novo--Trost2022 G
NELL1     2-1377-003chr11:
21322995-21323000
CAATGGCintronicDe novo--Trost2022 G
NELL1     3-0432-000chr11:
20954195-20954195
GAintronicDe novo--Trost2022 G
Yuen2016 G
Yuen2017 G
NELL1     4-0082-003chr11:
21330922-21330922
AGintronicDe novo--Trost2022 G
NELL1     10-0001-003chr11:
21236230-21236230
CTintronicDe novo--Trost2022 G
NELL1     5-5024-003chr11:
21321157-21321157
ACintronicDe novo--Trost2022 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More