
Results for "LINC01139"

Variant Events: 85

Gene symbol on which the variant is located
Subject Identifier from the original study
Genomic location of the reference allele
Reference allele
Alternate allele
Variant functional categories
Variant validation performed by an orthogonal method and reported
Reported inheritance status
Variant effect on transcript per Annovar
Transcript used for the cDNA/Protein mutation
cDNA variant notation
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Source(s) where variants from this event are reported
LINC01139     1-0403-004chr1:
TAintergenicDe novo--Yuen2017 G
LINC01139     2-1306-004chr1:
TCintergenicDe novo--Yuen2017 G
LINC01139     1-0481-003chr1:
GGTGGTTintergenicDe novo--Yuen2017 G
LINC01139     2-1620-004chr1:
GCintergenicDe novo--Yuen2017 G
LINC01139     AU025704chr1:
GCintergenicDe novo--Yuen2017 G
LINC01139     13143.p1chr1:
CCTTCintergenicDe novo--Wilfert2021 G
LINC01139     AU1355301chr1:
GAintergenicDe novo--Yuen2017 G
LINC01139     1-0436-003chr1:
CGintergenicDe novo--Yuen2016 G
Yuen2017 G
LINC01139     AU2863302chr1:
ATintergenicDe novo--Yuen2017 G
LINC01139     5-0014-003chr1:
TAintergenicDe novo--Yuen2017 G
LINC01139     AU3397302chr1:
ATTTTTTTATTTTTTintergenicDe novo--Yuen2017 G
LINC01139     2-0286-004chr1:
TTTCTintergenicDe novo--Yuen2017 G
LINC01139     AU4444304chr1:
AGintergenicDe novo--Yuen2017 G
LINC01139     AU1223301chr1:
CTTTTCTTTintergenicDe novo--Yuen2017 G
LINC01139     AU2075301chr1:
TACACACACACATACACACACAintergenicDe novo--Yuen2017 G
LINC01139     1-0381-003chr1:
CTintergenicDe novo--Yuen2017 G
LINC01139     2-1292-004chr1:
TCintergenicDe novo--Trost2022 G
Yuen2017 G
LINC01139     2-1425-003chr1:
ATintergenicDe novo--Yuen2017 G
LINC01139     AU2793303chr1:
TCintergenicDe novo--Yuen2017 G
LINC01139     1-0067-004chr1:
GAintergenicDe novo--Yuen2017 G
LINC01139     2-1306-003chr1:
TCintergenicDe novo--Yuen2017 G
LINC01139     1-0627-006chr1:
TCintergenicDe novo--Yuen2017 G
LINC01139     AU3913303chr1:
GTintergenicDe novo--Yuen2017 G
LINC01139     1-0652-004chr1:
TCintergenicDe novo--Trost2022 G
Yuen2017 G
LINC01139     1-0490-003chr1:
TCintergenicDe novo--Yuen2017 G
LINC01139     2-1183-003chr1:
TCintergenicDe novo--Yuen2017 G
LINC01139     AU2000305chr1:
GAintergenicDe novo--Yuen2017 G
LINC01139     2-0223-003chr1:
TTATCintergenicDe novo--Yuen2017 G
LINC01139     1-0446-003chr1:
TAATATintergenicDe novo--Yuen2017 G
LINC01139     A20chr1:
CTintergenicDe novo--Wu2018 G
LINC01139     AU056804chr1:
TCintergenicDe novo--Yuen2017 G
LINC01139     AU4164301chr1:
AGintergenicDe novo--Yuen2017 G
LINC01139     2-0305-004chr1:
GTintergenicDe novo--Yuen2017 G
LINC01139     7-0055-003chr1:
GAintergenicDe novo--Yuen2017 G
LINC01139     1-0175-004chr1:
GTintergenicDe novo--Yuen2017 G
LINC01139     2-1313-003chr1:
CTintergenicDe novo--Yuen2016 G
Yuen2017 G
LINC01139     AU2441301chr1:
GCintergenicDe novo--Trost2022 G
LINC01139     2-1266-003chr1:
GAintergenicDe novo--Yuen2016 G
Yuen2017 G
LINC01139     AU2698301chr1:
TCintergenicDe novo--Trost2022 G
LINC01139     4-0062-003chr1:
AGTTintergenicDe novo--Trost2022 G
LINC01139     AU3586303chr1:
ATintergenicDe novo--Yuen2017 G
LINC01139     2-1292-003chr1:
CTintergenicDe novo--Yuen2017 G
LINC01139     AU2318301chr1:
ACintergenicDe novo--Trost2022 G
LINC01139     REACH000293chr1:
CTintergenicDe novo--Trost2022 G
LINC01139     AU2320301chr1:
CTintergenicDe novo--Trost2022 G
LINC01139     1-0487-003chr1:
CGintergenicDe novo--Yuen2016 G
Yuen2017 G
LINC01139     AU3721302chr1:
CGintergenicDe novo--Yuen2017 G
LINC01139     1-1063-003chr1:
GAintergenicDe novo--Trost2022 G
LINC01139     2-1105-003chr1:
GTintergenicDe novo--Trost2022 G
Yuen2016 G
Yuen2017 G
LINC01139     2-1305-003chr1:
TCintergenicDe novo--Yuen2016 G
Yuen2017 G
LINC01139     AU3891303chr1:
GAintergenicDe novo--Yuen2017 G
LINC01139     AU2283301chr1:
ATAintergenicDe novo--Trost2022 G
LINC01139     1-0319-004chr1:
TCintergenicDe novo--Trost2022 G
LINC01139     2-0028-003chr1:
TAintergenicDe novo--Yuen2016 G
Yuen2017 G
LINC01139     5-0009-003chr1:
AGintergenicDe novo--Trost2022 G
LINC01139     MSSNG00257-005chr1:
AGintergenicDe novo--Trost2022 G
LINC01139     2-1085-003chr1:
CTintergenicDe novo--Yuen2017 G
LINC01139     3-0661-000chr1:
ATTATTTintergenicDe novo--Yuen2017 G
LINC01139     AU4056301chr1:
TAintergenicDe novo--Yuen2017 G
LINC01139     5-5119-003chr1:
GCintergenicDe novo--Trost2022 G
LINC01139     AU2320301chr1:
AGintergenicDe novo--Trost2022 G
LINC01139     1-0041-003chr1:
TCintergenicDe novo--Yuen2016 G
Yuen2017 G
LINC01139     AU054103chr1:
CGintergenicDe novo--Yuen2017 G
LINC01139     AU4176302chr1:
CAintergenicDe novo--Yuen2017 G
LINC01139     1-0019-004chr1:
AGintergenicDe novo--Yuen2017 G
LINC01139     1-0175-003chr1:
GTintergenicDe novo--Yuen2017 G
LINC01139     AU3937301chr1:
GCintergenicDe novo--Yuen2017 G
LINC01139     3-0456-000chr1:
AAGAAAintergenicDe novo--Yuen2017 G
LINC01139     3-0111-000chr1:
ACintergenicDe novo--Yuen2016 G
LINC01139     2-1176-003chr1:
GAintergenicDe novo--Yuen2017 G
LINC01139     1-0965-003chr1:
CTintergenicDe novo--Yuen2017 G
LINC01139     7-0249-004chr1:
CAintergenicDe novo--Trost2022 G
Yuen2017 G
LINC01139     AU2075302chr1:
TACACACACACATACACACACAintergenicDe novo--Yuen2017 G
LINC01139     2-1510-003chr1:
LINC01139     AU024607chr1:
AGintergenicDe novo--Yuen2017 G
LINC01139     2-1196-003chr1:
GAintergenicDe novo--Yuen2016 G
LINC01139     AU0540301 Complex Event; expand row to view variants  De novo--Trost2022 G
Yuen2017 G
LINC01139     AU4264302chr1:
ACintergenicDe novo--Yuen2017 G
LINC01139     AU2950301chr1:
CTTTTTCTTTintergenicDe novo--Yuen2017 G
LINC01139     AU4027306chr1:
GCintergenicDe novo--Yuen2017 G
LINC01139     2-1093-005chr1:
GCintergenicDe novo--Yuen2017 G
LINC01139     2-1220-003chr1:
TGintergenicDe novo--Yuen2016 G
Yuen2017 G
LINC01139     AU4237302 Complex Event; expand row to view variants  De novo--Trost2022 G
Trost2022 G
Yuen2017 G
Yuen2017 G
LINC01139     2-0273-003chr1:
ACintergenicDe novo--Yuen2017 G
LINC01139     2-1339-003chr1:
TCintergenicDe novo--Yuen2017 G
Source Variant Information

, -


Paper alias:

No records found.
Paper Information
Variant source
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView