or
or
Exact

Results for "GRIK4"

Variant Events: 66

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
GRIK4     09C82563chr11:
120690516-120690516
GTexonicDe novononsynonymous SNVNM_001282470
NM_001282473
NM_014619
c.G398T
c.G398T
c.G398T
p.R133I
p.R133I
p.R133I
28.0-DeRubeis2014 E
Fu2022 E
Kosmicki2017 E
Lim2017 E
Satterstrom2020 E
Trost2022 G
Zhou2022 GE
GRIK4     AU3721302chr11:
120734048-120734048
GAintronicDe novo--Trost2022 G
Yuen2017 G
GRIK4     AU2951302chr11:
120449621-120449621
CTintronicDe novo--Yuen2017 G
GRIK4     13649.p1chr11:
120658896-120658896
AGintronicDe novo--Turner2016 G
GRIK4     1-0051-004chr11:
120872269-120872269
TTCAAintergenicDe novo--Yuen2017 G
GRIK4     14637.p1chr11:
120699626-120699626
GAintronicDe novo--Turner2016 G
GRIK4     2-1430-003chr11:
120562853-120562853
GAintronicDe novo--Yuen2016 G
Yuen2017 G
GRIK4     MSSNG00239-003chr11:
120471206-120471206
CTintronicDe novo--Trost2022 G
GRIK4     MSSNG00038-004chr11:
120494235-120494235
AGintronicDe novo--Trost2022 G
GRIK4     AU075703chr11:
120579120-120579120
CTintronicDe novo--Trost2022 G
Yuen2017 G
GRIK4     MSSNG00042-004chr11:
120443488-120443488
AGintronicDe novo--Trost2022 G
GRIK4     REACH000368chr11:
120445713-120445713
TCintronicDe novo--Trost2022 G
GRIK4     REACH000341chr11:
120404834-120404834
CTintronicDe novo--Trost2022 G
GRIK4     3-0476-000chr11:
120415880-120415880
GAintronicDe novo--Trost2022 G
GRIK4     REACH000681chr11:
120399514-120399514
CTintronicDe novo--Trost2022 G
GRIK4     3-0287-000chr11:
120568091-120568091
GAintronicDe novo--Trost2022 G
GRIK4     7-0240-003chr11:
120574522-120574522
GCintronicDe novo--Trost2022 G
GRIK4     2-1430-003Achr11:
120562853-120562853
GAintronicDe novo--Trost2022 G
GRIK4     14-591chr11:
120566673-120566673
CTintronicDe novo--Trost2022 G
GRIK4     7-0252-003chr11:
120545856-120545856
TCintronicDe novo--Trost2022 G
GRIK4     7-0230-003chr11:
120548648-120548648
TCintronicDe novo--Trost2022 G
GRIK4     7-0240-003chr11:
120518242-120518242
GAintronicDe novo--Trost2022 G
GRIK4     13825.p1chr11:
120674783-120674783
TCintronicDe novo--Wilfert2021 G
GRIK4     3-0749-000Achr11:
120541168-120541168
CAintronicDe novo--Trost2022 G
GRIK4     MSSNG00341-003chr11:
120643166-120643166
GCintronicDe novo--Trost2022 G
GRIK4     1-0133-003chr11:
120652895-120652895
CCTAGAintronicDe novo--Trost2022 G
GRIK4     7-0438-003chr11:
120628559-120628559
GCintronicDe novo--Trost2022 G
GRIK4     AU2463301chr11:
120632795-120632795
GAintronicDe novo--Trost2022 G
GRIK4     AU3728301chr11:
120491942-120491942
TGintronicDe novo--Trost2022 G
Yuen2017 G
GRIK4     4-0062-003chr11:
120618986-120618987
CTGAintronicDe novo--Trost2022 G
GRIK4     MSSNG00409-003chr11:
120621270-120621271
GTGintronicDe novo--Trost2022 G
GRIK4     3-0713-000chr11:
120587779-120587779
CTintronicDe novo--Trost2022 G
GRIK4     AU061003chr11:
120594675-120594675
CTintronicDe novo--Trost2022 G
GRIK4     2-1763-003chr11:
120795176-120795176
CTintronicDe novo--Trost2022 G
GRIK4     10-1127-003Achr11:
120797701-120797701
CTintronicDe novo--Trost2022 G
GRIK4     REACH000589chr11:
120793657-120793657
CTintronicDe novo--Trost2022 G
GRIK4     MSSNG00241-003chr11:
120715375-120715375
CTintronicDe novo--Trost2022 G
GRIK4     2-1795-003chr11:
120737102-120737102
GAintronicDe novo--Trost2022 G
GRIK4     1-0590-003chr11:
120508586-120508606
TTTATTATTATTATTATTATTTTTATTATTATTATTATTintronicDe novo--Yuen2017 G
GRIK4     14-1775chr11:
120661918-120661918
CTintronicDe novo--Trost2022 G
GRIK4     MT_50.3chr11:
120678898-120678898
AGintronicDe novo--Trost2022 G
GRIK4     AU3918302chr11:
120772419-120772419
GAintronicDe novo--Trost2022 G
Yuen2017 G
GRIK4     1-1084-003chr11:
120857396-120857396
GTUTR3De novo--Trost2022 G
GRIK4     AU060004chr11:
120420210-120420210
CTintronicDe novo--Trost2022 G
Yuen2017 G
GRIK4     3-0708-000chr11:
120851586-120851586
GTintronicDe novo--Trost2022 G
GRIK4     1-0261-004chr11:
120478010-120478010
CTintronicDe novo--Trost2022 G
Yuen2017 G
GRIK4     SP0189580chr11:
120856981-120856981
ATUTR3De novo--Trost2022 G
GRIK4     A25chr11:
120390893-120390893
CTintronicDe novo--Wu2018 G
GRIK4     1-0531-003chr11:
120622748-120622748
CGintronicDe novo--Trost2022 G
Yuen2016 G
Yuen2017 G
GRIK4     AU4234303chr11:
120702650-120702651
ACAexonicPaternalframeshift deletionNM_001282470
NM_001282473
NM_014619
c.602delC
c.602delC
c.602delC
p.T201fs
p.T201fs
p.T201fs
--Cirnigliaro2023 G
GRIK4     mAGRE4927chr11:
120524393-120524393
GTsplicingPaternalsplicing--Cirnigliaro2023 G
GRIK4     2-1402-003chr11:
120495291-120495291
CTintronicDe novo--Trost2022 G
Yuen2017 G
GRIK4     5-0131-003chr11:
120715924-120715924
GCintronicDe novo--Trost2022 G
Yuen2017 G
GRIK4     AU2777302chr11:
120738545-120738545
CTintronicDe novo--Trost2022 G
Yuen2017 G
GRIK4     AU046707chr11:
120680172-120680172
CTintronicDe novo--Trost2022 G
Yuen2017 G
GRIK4     iHART3297chr11:
120702650-120702651
ACAexonicPaternalframeshift deletionNM_001282470
NM_001282473
NM_014619
c.602delC
c.602delC
c.602delC
p.T201fs
p.T201fs
p.T201fs
--Ruzzo2019 G
GRIK4     A1409Bchr11:
120776054-120776054
GAexonicDe novononsynonymous SNVNM_001282470
NM_001282473
NM_014619
c.G1328A
c.G1328A
c.G1328A
p.R443H
p.R443H
p.R443H
23.3-Fu2022 E
GRIK4     2-0319-004chr11:
120433928-120433928
GTintronicDe novo--Yuen2017 G
GRIK4     7-0219-003chr11:
120435614-120435614
GAintronicDe novo--Trost2022 G
Yuen2017 G
GRIK4     7-0032-003chr11:
120788498-120788498
TCintronicDe novo--Yuen2017 G
GRIK4     SP0072844chr11:
120531190-120531190
CAintronicDe novo--Fu2022 E
GRIK4     1-0466-003chr11:
120717962-120717962
AGintronicDe novo--Trost2022 G
Yuen2017 G
GRIK4     5-0103-003chr11:
120414524-120414524
AGintronicDe novo--Trost2022 G
Yuen2017 G
GRIK4     AU2951303chr11:
120449621-120449621
CTintronicDe novo--Yuen2017 G
GRIK4     2-1477-003chr11:
120662944-120662976
CGTGTGTGTGTGTGTGTGCGTGTGTGTGTGTGTCGTGTGTGTGTGTGTGCGTGTGTGTGTGTGTintronicDe novo--Yuen2017 G
GRIK4     2-1252-003chr11:
120444344-120444344
CTintronicDe novo--Trost2022 G
Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More