or
or
Exact

Results for "CORO1C"

Variant Events: 25

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
CORO1C     SP0001591chr12:
109041174-109041174
GCUTR3De novo--Fu2022 E
CORO1C     14415.p1chr12:
109042371-109042371
TCintronicMosaic--Dou2017 E
CORO1C     2-1509-003chr12:
109052794-109052825
CAGAGAGAGAGAGAGAGAAAGAGAGAGAGAGACAGAGAGAGAGAGAGAAAGAGAGAGAGAGAintronicDe novo--Yuen2017 G
CORO1C     AU3912302chr12:
109062731-109062731
CTintronicDe novo--Trost2022 G
Yuen2017 G
CORO1C     2-0202-004chr12:
109100158-109100158
TTCCACintronicDe novo--Trost2022 G
Yuen2017 G
CORO1C     AU2975302chr12:
109105203-109105203
CTintronicDe novo--Yuen2017 G
CORO1C     2-1353-003chr12:
109150560-109150560
GAintergenicDe novo--Yuen2016 G
Yuen2017 G
CORO1C     5-0129-003chr12:
109114551-109114551
AGintronicDe novo--Trost2022 G
CORO1C     5-0129-003chr12:
109114558-109114558
TCintronicDe novo--Trost2022 G
CORO1C     5-0129-003chr12:
109114542-109114542
AGintronicDe novo--Trost2022 G
CORO1C     5-0129-003chr12:
109114547-109114547
CTintronicDe novo--Trost2022 G
CORO1C     2-0202-003chr12:
109100158-109100158
TTCCACintronicDe novo--Trost2022 G
Yuen2017 G
CORO1C     REACH000144chr12:
109072945-109072945
TAintronicDe novo--Trost2022 G
CORO1C     MT_179.4chr12:
109093054-109093054
AGintronicDe novo--Trost2022 G
CORO1C     SP0357723chr12:
109094940-109094940
GAexonicnonsynonymous SNVNM_001105237
NM_001276471
NM_014325
c.C314T
c.C155T
c.C155T
p.A105V
p.A52V
p.A52V
34.0-Zhou2022 GE
CORO1C     AU3839303chr12:
109124982-109124982
CAintronicDe novo--Trost2022 G
Yuen2017 G
CORO1C     AU043804chr12:
109095064-109095064
GAexonicDe novononsynonymous SNVNM_001105237
NM_001276471
NM_014325
c.C190T
c.C31T
c.C31T
p.R64W
p.R11W
p.R11W
24.9-Trost2022 G
Yuen2017 G
Zhou2022 GE
CORO1C     AU1987301chr12:
109051115-109051115
GAexonicDe novononsynonymous SNVNM_001105237
NM_001276471
NM_014325
c.C874T
c.C715T
c.C715T
p.R292C
p.R239C
p.R239C
34.0-Trost2022 G
Yuen2017 G
Zhou2022 GE
CORO1C     MSSNG00018-003chr12:
109125514-109125514
CAupstreamDe novo--Trost2022 G
CORO1C     AU4379301chr12:
109073143-109073143
TCintronicDe novo--Trost2022 G
Yuen2017 G
CORO1C     2-1277-003chr12:
109094300-109094301
TCTintronicDe novo--Trost2022 G
Yuen2017 G
CORO1C     ASC_3C569chr12:
109042551-109042551
CGexonicDe novononsynonymous SNVNM_001105237
NM_001276471
NM_014325
c.G1294C
c.G1135C
c.G1135C
p.E432Q
p.E379Q
p.E379Q
15.1-Fu2022 E
CORO1C     13750.p1chr12:
109085455-109085455
GAintronicDe novo--Wilfert2021 G
CORO1C     2-1277-003chr12:
109171475-109171475
GAintergenicDe novo--Trost2022 G
Yuen2017 G
CORO1C     2469_17auchr12:
109048338-109048338
ACintronicDe novo--Fu2022 E
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More