or
or
Exact

Results for "SEPHS1"

Variant Events: 10

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
SEPHS1     7-0369-003chr10:
13376213-13376213
TCintronicDe novo--Trost2022 G
SEPHS1     5-5164-003chr10:
13361209-13361209
CTexonicDe novononsynonymous SNVNM_001195602
NM_001195604
NM_012247
c.G911A
c.G899A
c.G1112A
p.R304Q
p.R300Q
p.R371Q
16.8-Trost2022 G
Zhou2022 GE
SEPHS1     AU4129303chr10:
13393039-13393039
TGintergenicDe novo--Yuen2017 G
SEPHS1     MSSNG00329-003chr10:
13376049-13376049
GGTTintronicDe novo--Trost2022 G
SEPHS1     12497.p1chr10:
13390593-13390595
CAACupstreamDe novo--Wilfert2021 G
SEPHS1     MSSNG00329-003chr10:
13376055-13376055
AACTTTTTATAACTTTTTATintronicDe novo--Trost2022 G
SEPHS1     1-1055-003chr10:
13370850-13370850
CAintronicDe novo--Trost2022 G
SEPHS1     AU2320301chr10:
13373256-13373256
CTintronicDe novo--Trost2022 G
SEPHS1     1-0675-003chr10:
13385715-13385715
GAintronicDe novo--Trost2022 G
Yuen2017 G
SEPHS1     AU4263304 Complex Event; expand row to view variants  De novo--Trost2022 G
Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More