or
or
Exact

Results for "TSNARE1"

Variant Events: 73

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
TSNARE1     2-1430-005Achr8:
143323937-143323937
CTintronicDe novo--Trost2022 G
TSNARE1     1-0330-004chr8:
143353964-143353964
CCCCGCCTGTCTACACCTTCCTCTTTCCATCCACCTGTintronicDe novo--Yuen2017 G
TSNARE1     SJD_34.3chr8:
143330476-143330476
TCintronicDe novo--Trost2022 G
TSNARE1     2-1434-003chr8:
143304683-143304683
TCintronicDe novo--Trost2022 G
TSNARE1     3-0485-000Achr8:
143314282-143314282
AGintronicDe novo--Trost2022 G
TSNARE1     1-1126-003chr8:
143304188-143304188
CTintronicDe novo--Trost2022 G
TSNARE1     2-1268-003chr8:
143304683-143304683
TCintronicDe novo--Trost2022 G
TSNARE1     1-1006-003A Complex Event; expand row to view variants  De novo--Trost2022 G
Trost2022 G
TSNARE1     MSSNG00108-003chr8:
143337729-143337729
CAintronicDe novo--Trost2022 G
TSNARE1     1-0158-003chr8:
143513546-143513546
CAintergenicDe novo--Yuen2017 G
TSNARE1     MT_82.3chr8:
143337729-143337729
CAintronicDe novo--Trost2022 G
TSNARE1     SJD_45.3chr8:
143337714-143337714
CAintronicDe novo--Trost2022 G
TSNARE1     AU3918302chr8:
143337729-143337729
CAintronicDe novo--Trost2022 G
TSNARE1     74-0115chr8:
143516797-143516797
CTintergenicDe novo--Michaelson2012 G
TSNARE1     MT_107.3chr8:
143337714-143337714
CAintronicDe novo--Trost2022 G
TSNARE1     MT_35.3chr8:
143337714-143337714
CAintronicDe novo--Trost2022 G
TSNARE1     MT_107.3chr8:
143337665-143337665
CTintronicDe novo--Trost2022 G
TSNARE1     MSSNG00108-003chr8:
143337704-143337704
TCintronicDe novo--Trost2022 G
TSNARE1     1-0644-003chr8:
143363763-143363763
AGintronicDe novo--Trost2022 G
TSNARE1     1-0412-003chr8:
143381164-143381164
GAintronicDe novo--Trost2022 G
Yuen2017 G
TSNARE1     2-1177-003chr8:
143363763-143363763
AGintronicDe novo--Trost2022 G
TSNARE1     7-0459-003chr8:
143363761-143363761
TGintronicDe novo--Trost2022 G
TSNARE1     9-0027-003chr8:
143363761-143363764
TCAGGCGGAintronicDe novo--Trost2022 G
TSNARE1     1-0644-003chr8:
143363761-143363761
TGintronicDe novo--Trost2022 G
TSNARE1     2-1177-003chr8:
143363761-143363761
TGintronicDe novo--Trost2022 G
TSNARE1     4897chr8:
143356191-143356191
GAexonicDe novononsynonymous SNVNM_001291931
NM_145003
c.C740T
c.C1397T
p.S247L
p.S466L
9.587-Trost2022 G
TSNARE1     SP0149989chr8:
143357270-143357270
GAintronicDe novo--Trost2022 G
TSNARE1     2-1277-003chr8:
143381830-143381831
GCGintronicDe novo-8.644E-6Trost2022 G
TSNARE1     MSSNG00398-003chr8:
143386490-143386490
AGintronicDe novo--Trost2022 G
TSNARE1     3-0018-000chr8:
143363804-143363804
GCintronicDe novo--Trost2022 G
TSNARE1     2-1155-003chr8:
143363888-143363888
TCintronicDe novo--Trost2022 G
TSNARE1     7-0459-003chr8:
143363783-143363783
TCintronicDe novo--Trost2022 G
TSNARE1     AU4237302chr8:
143341841-143341841
CTintronicDe novo--Trost2022 G
Yuen2017 G
TSNARE1     7-0459-003chr8:
143363796-143363796
ACintronicDe novo--Trost2022 G
TSNARE1     7-0459-003chr8:
143363763-143363763
AGintronicDe novo--Trost2022 G
TSNARE1     7-0459-003chr8:
143363781-143363781
AGintronicDe novo--Trost2022 G
TSNARE1     MSSNG00367-004chr8:
143470083-143470083
TCintronicDe novo--Trost2022 G
TSNARE1     7-0150-003chr8:
143475557-143475557
GAintronicDe novo--Trost2022 G
TSNARE1     MSSNG00421-008chr8:
143415367-143415367
GAintronicDe novo--Trost2022 G
TSNARE1     AU007032chr8:
143425442-143425442
GAexonicDe novosynonymous SNVNM_145003c.C630Tp.S210S--DeRubeis2014 E
Fu2022 E
Kosmicki2017 E
Lim2017 E
Satterstrom2020 E
Trost2022 G
Zhou2022 GE
TSNARE1     SP0078423chr8:
143427293-143427293
ACintronicDe novo--Trost2022 G
TSNARE1     3-0648-000chr8:
143407294-143407294
GCintronicDe novo--Trost2022 G
TSNARE1     3-0204-000chr8:
143407553-143407553
GCintronicDe novo--Trost2022 G
TSNARE1     4-0108-003chr8:
143392321-143392321
GAintronicDe novo--Trost2022 G
TSNARE1     MSSNG00235-003chr8:
143398359-143398359
CTintronicDe novo--Trost2022 G
TSNARE1     13557.p1chr8:
143356191-143356191
GAexonicDe novononsynonymous SNVNM_001291931
NM_145003
c.C740T
c.C1397T
p.S247L
p.S466L
9.587-Iossifov2014 E
Kosmicki2017 E
O’Roak2012b E
Satterstrom2020 E
Wilfert2021 G
Zhou2022 GE
TSNARE1     7-0150-003chr8:
143475605-143475605
GAintronicDe novo--Trost2022 G
TSNARE1     11411.p1chr8:
143425725-143425725
GCexonicDe novononsynonymous SNVNM_145003c.C347Gp.P116R8.317-Iossifov2014 E
Kosmicki2017 E
Satterstrom2020 E
Trost2022 G
Wilfert2021 G
Zhou2022 GE
TSNARE1     1-0119-004chr8:
143456964-143456964
GAintronicDe novo--Trost2022 G
Yuen2017 G
TSNARE1     2-1366-003chr8:
143445238-143445238
CTintronicDe novo--Trost2022 G
Yuen2017 G
TSNARE1     2-1391-003chr8:
143494773-143494773
AACintergenicDe novo--Yuen2017 G
TSNARE1     2-1408-004chr8:
143342374-143342374
AAAGAAGGGAAGintronicDe novo--Yuen2017 G
TSNARE1     2-1341-004chr8:
143432016-143432016
GAintronicDe novo--Trost2022 G
Yuen2017 G
TSNARE1     2-0142-003chr8:
143513595-143513595
TTCCCCCGTAACintergenicDe novo--Yuen2017 G
TSNARE1     2-1485-003chr8:
143513617-143513617
TCintergenicDe novo--Yuen2017 G
TSNARE1     1-0394-003chr8:
143316703-143316703
GAintronicDe novo--Trost2022 G
Yuen2017 G
TSNARE1     2-1731-003chr8:
143341025-143341025
ACintronicDe novo--Trost2022 G
Yuen2017 G
TSNARE1     2-1277-003chr8:
143381837-143381848
CCAGCCTCACCTGexonicDe novoframeshift substitutionNM_001291931
NM_145003
c.632_633C
c.1289_1290C
N/A
N/A
--Trost2022 G
Zhou2022 GE
TSNARE1     A20chr8:
143412910-143412910
CTintronicDe novo--Wu2018 G
TSNARE1     AU4284301chr8:
143516350-143516385
CTCGCACACACATGCACTTTCACACACACATGCACTCTCACACACACATGCACTintergenicDe novo--Yuen2017 G
TSNARE1     1-0744-003chr8:
143496539-143496539
GAintergenicDe novo--Yuen2017 G
TSNARE1     1-0756-005chr8:
143513703-143513704
TCTintergenicDe novo--Yuen2017 G
TSNARE1     iHART3237chr8:
143412308-143412308
GAexonicMaternalstopgainNM_001291931
NM_145003
c.C190T
c.C847T
p.Q64X
p.Q283X
37.08.275E-6Ruzzo2019 G
TSNARE1     mAGRE3240chr8:
143412308-143412308
GAexonicMaternalstopgainNM_001291931
NM_145003
c.C190T
c.C847T
p.Q64X
p.Q283X
37.08.275E-6Cirnigliaro2023 G
TSNARE1     mAGRE3237chr8:
143412308-143412308
GAexonicMaternalstopgainNM_001291931
NM_145003
c.C190T
c.C847T
p.Q64X
p.Q283X
37.08.275E-6Cirnigliaro2023 G
TSNARE1     iHART3242chr8:
143412308-143412308
GAexonicMaternalstopgainNM_001291931
NM_145003
c.C190T
c.C847T
p.Q64X
p.Q283X
37.08.275E-6Ruzzo2019 G
TSNARE1     iHART3240chr8:
143412308-143412308
GAexonicMaternalstopgainNM_001291931
NM_145003
c.C190T
c.C847T
p.Q64X
p.Q283X
37.08.275E-6Ruzzo2019 G
TSNARE1     1-0606-003chr8:
143471531-143471531
GAintronicDe novo--Trost2022 G
Yuen2017 G
TSNARE1     iHART2245chr8:
143425762-143425762
CCCCCTexonicPaternalframeshift insertionNM_145003c.309_310insAGGGp.D104fs--Ruzzo2019 G
TSNARE1     iHART2244chr8:
143425762-143425762
CCCCCTexonicPaternalframeshift insertionNM_145003c.309_310insAGGGp.D104fs--Ruzzo2019 G
TSNARE1     mAGRE2245chr8:
143425762-143425762
CCCCCTexonicPaternalframeshift insertionNM_145003c.309_310insAGGGp.D104fs--Cirnigliaro2023 G
TSNARE1     mAGRE2244chr8:
143425762-143425762
CCCCCTexonicPaternalframeshift insertionNM_145003c.309_310insAGGGp.D104fs--Cirnigliaro2023 G
TSNARE1     mAGRE3242chr8:
143412308-143412308
GAexonicMaternalstopgainNM_001291931
NM_145003
c.C190T
c.C847T
p.Q64X
p.Q283X
37.08.275E-6Cirnigliaro2023 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More