or
or
Exact

Results for "PHC2"

Variant Events: 16

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
PHC2     1-0972-003chr1:
33890415-33890415
TGintergenicDe novo--Yuen2017 G
PHC2     AU2109301chr1:
33798625-33798625
GAintronicDe novo--Trost2022 G
Yuen2017 G
PHC2     2-1757-003chr1:
33800514-33800514
CTintronicDe novo--Trost2022 G
PHC2     1-0290-003chr1:
33885368-33885368
GAintergenicDe novo--Yuen2017 G
PHC2     1-0496-003chr1:
33892847-33892847
AGintergenicDe novo--Yuen2016 G
Yuen2017 G
PHC2     MSSNG00435-003chr1:
33796401-33796401
TCintronicDe novo--Trost2022 G
PHC2     SP0169697chr1:
33820115-33820115
CGexonicDe novononsynonymous SNVNM_198040c.G1442Cp.S481T13.821.66E-5Trost2022 G
PHC2     SP0218460chr1:
33815442-33815442
GTUTR5De novo--Trost2022 G
PHC2     AU1987301chr1:
33911883-33911884
AGAintergenicDe novo--Yuen2017 G
PHC2     14547.p1chr1:
33858459-33858459
GAintergenicDe novo--Wilfert2021 G
PHC2     SP0051418chr1:
33834138-33834156
TGGGCGGGGGTGGGGGGCCTexonicDe novononframeshift deletionNM_198040c.644_661delp.215_221del--Fu2022 E
Zhou2022 GE
PHC2     3-0534-000chr1:
33832581-33832581
GAintronicDe novo--Trost2022 G
PHC2     SP0169697chr1:
33820678-33820678
CTexonicDe novononsynonymous SNVNM_198040c.G1153Ap.V385M10.328.934E-6Trost2022 G
PHC2     MSSNG00400-003chr1:
33836991-33836991
CGintronicDe novo--Trost2022 G
PHC2     SP0095864chr1:
33812539-33812540
AGAintronicDe novo--Fu2022 E
Trost2022 G
PHC2     MSSNG00031-004chr1:
33836971-33836971
GAintronicDe novo--Trost2022 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More