or
or
Exact

Results for "CFAP54"

Variant Events: 45

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
CFAP54     1-0706-003chr12:
97055347-97055347
GAintronicDe novo--Trost2022 G
Yuen2017 G
CFAP54     AU2569303chr12:
96951884-96951884
TCintronicDe novo--Trost2022 G
Yuen2017 G
CFAP54     1-0395-003chr12:
97194715-97194715
AGintronicDe novo--Trost2022 G
Yuen2017 G
CFAP54     1-0559-003chr12:
97128074-97128074
TCintronicDe novo--Trost2022 G
Yuen2017 G
CFAP54     AU3302302chr12:
97248363-97248363
AGintronicDe novo--Trost2022 G
Yuen2017 G
CFAP54     2-1725-003chr12:
97205572-97205572
CAexonicDe novononsynonymous SNVNM_001306084c.C8909Ap.S2970Y12.98-Trost2022 G
Yuen2017 G
Zhou2022 GE
CFAP54     1-0755-003chr12:
97202394-97202394
TCintronicDe novo--Trost2022 G
Yuen2017 G
CFAP54     3-0221-000chr12:
96905663-96905669
GTTACAAGintronicDe novo--Trost2022 G
CFAP54     2-1205-003chr12:
97192274-97192274
TCintronicDe novo--Yuen2016 G
Yuen2017 G
CFAP54     REACH000597chr12:
96933912-96933912
GAintronicDe novo--Trost2022 G
CFAP54     AU1404301chr12:
97221391-97221391
AGintronicDe novo--Yuen2017 G
CFAP54     1-0191-003chr12:
96991433-96991433
TTACintronicDe novo--Trost2022 G
Yuen2017 G
CFAP54     AU1448303chr12:
97014203-97014203
CTintronicDe novo--Trost2022 G
CFAP54     1-0928-003chr12:
97051274-97051274
CTintronicDe novo--Trost2022 G
CFAP54     A28chr12:
96957694-96957694
CTintronicDe novo--Wu2018 G
CFAP54     AU2579302chr12:
96994519-96994519
CTintronicDe novo--Trost2022 G
CFAP54     MSSNG00206-003chr12:
97005013-97005013
TAintronicDe novo--Trost2022 G
CFAP54     MSSNG00343-003chr12:
96965253-96965253
AGintronicDe novo--Trost2022 G
CFAP54     SJD_49.4chr12:
96989690-96989690
TCintronicDe novo--Trost2022 G
CFAP54     AU2639301chr12:
96942416-96942416
CTintronicDe novo--Trost2022 G
CFAP54     1-0395-004chr12:
97194715-97194715
AGintronicDe novo--Yuen2017 G
CFAP54     7-0314-003Achr12:
96942736-96942736
CAintronicDe novo--Trost2022 G
CFAP54     7-0399-003chr12:
97131712-97131712
CTintronicDe novo--Trost2022 G
CFAP54     1-0553-003chr12:
97164006-97164006
GGAATintronicDe novo--Trost2022 G
CFAP54     MSSNG00018-003chr12:
97124888-97124888
AGintronicDe novo--Trost2022 G
CFAP54     3-0484-000chr12:
97128350-97128351
TGTintronicDe novo--Trost2022 G
CFAP54     5-0053-003chr12:
97095283-97095283
AGintronicDe novo--Trost2022 G
CFAP54     14-1011chr12:
97121025-97121028
CGTTCintronicDe novo--Trost2022 G
CFAP54     MSSNG00201-003chr12:
97077615-97077615
GTintronicDe novo--Trost2022 G
CFAP54     5-5170-003chr12:
97089417-97089417
CGintronicDe novo--Trost2022 G
CFAP54     1-1134-003chr12:
97262620-97262620
AGintronicDe novo--Trost2022 G
CFAP54     4-0062-003chr12:
97262865-97262866
TAATintronicDe novo--Trost2022 G
CFAP54     REACH000735chr12:
97242139-97242139
GAintronicDe novo--Trost2022 G
CFAP54     1-0007-003chr12:
96929365-96929365
GAexonicDe novononsynonymous SNVNM_001306084c.G1778Ap.C593Y5.731-Yuen2017 G
Zhou2022 GE
CFAP54     2-1142-003chr12:
97277413-97277413
ATintergenicDe novo--Yuen2017 G
CFAP54     MSSNG00037-004Achr12:
97253839-97253839
CCTintronicDe novo--Trost2022 G
CFAP54     AU1448303chr12:
97198544-97198544
ACintronicDe novo--Trost2022 G
CFAP54     4-0010-003chr12:
97230861-97230861
ATintronicDe novo--Trost2022 G
CFAP54     AU4067301chr12:
96960260-96960260
GAintronicDe novo--Trost2022 G
Yuen2017 G
CFAP54     AU4215302chr12:
96933911-96933911
CTintronicDe novo--Trost2022 G
Yuen2017 G
CFAP54     2-1348-003chr12:
96932258-96932258
GTexonicDe novononsynonymous SNVNM_001306084c.G1888Tp.D630Y12.23-Trost2022 G
Yuen2017 G
Zhou2022 GE
CFAP54     AU030804chr12:
97055129-97055129
TCintronicDe novo--Yuen2017 G
CFAP54     14544.p1chr12:
96915953-96915954
AGAexonicDe novoframeshift deletionNM_001306084c.1145delGp.R382fs--Wilfert2021 G
Zhou2022 GE
CFAP54     SP0112547chr12:
96932292-96932292
AAGGTACCATGATCTTGGCTCACTGCAACexonicDe novostopgainNM_001306084c.1922_1923insGGTACCATGATCTTGGCTCACTGCAACp.N641delinsKVPX--Fu2022 E
CFAP54     AU3907302chr12:
97012063-97012063
CTintronicDe novo--Trost2022 G
Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More