
Results for "FOXN4"

Variant Events: 15

Gene symbol on which the variant is located
Subject Identifier from the original study
Genomic location of the reference allele
Reference allele
Alternate allele
Variant functional categories
Variant validation performed by an orthogonal method and reported
Reported inheritance status
Variant effect on transcript per Annovar
Transcript used for the cDNA/Protein mutation
cDNA variant notation
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Source(s) where variants from this event are reported
FOXN4     1-0955-003chr12:
ACintronicDe novo--Trost2022 G
FOXN4     SP0086531chr12:
ACintronicDe novo--Trost2022 G
FOXN4     SP0037276chr12:
ACintronicDe novo--Trost2022 G
FOXN4     SP0037276chr12:
ACintronicDe novo--Trost2022 G
FOXN4     13637.p1chr12:
TAintergenicDe novo--Wilfert2021 G
FOXN4     SP0056651chr12:
ACintronicDe novo--Trost2022 G
FOXN4     2-0300-003chr12:
GAintergenicDe novo--Yuen2017 G
FOXN4     REACH000428chr12:
TAintronicDe novo--Trost2022 G
FOXN4     7902-03-003chr12:
GCAGGGCAGGGCAGGACAGGGCAGGCGintronicDe novo--Satterstrom2020 E
Trost2022 G
Zhou2022 GE
FOXN4     1-0520-003chr12:
GTintronicDe novo--Trost2022 G
Yuen2016 G
Yuen2017 G
FOXN4     1-0914-003chr12:
CTdownstreamDe novo--Trost2022 G
Yuen2017 G
FOXN4     5-0055-003chr12:
TACACTintergenicDe novo--Yuen2017 G
FOXN4     AU2333302chr12:
TAintergenicDe novo--Yuen2017 G
FOXN4     1-0161-003chr12:
GAintergenicDe novo--Yuen2017 G
FOXN4     1-0627-006chr12:
GCintergenicDe novo--Yuen2017 G
Source Variant Information

, -


Paper alias:

No records found.
Paper Information
Variant source
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView