or
or
Exact

Results for "ADAM8"

Variant Events: 14

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
ADAM8     mAGRE2627chr10:
135085204-135085206
CTGCexonicMaternalframeshift deletionNM_001164490
NM_001109
NM_001164489
c.993_994del
c.1110_1111del
c.1110_1111del
p.S331fs
p.S370fs
p.S370fs
-1.0E-4Cirnigliaro2023 G
ADAM8     mAGRE4697chr10:
135084304-135084304
GAexonicMaternalstopgainNM_001164490
NM_001109
NM_001164489
c.C1453T
c.C1570T
c.C1570T
p.Q485X
p.Q524X
p.Q524X
-1.0E-4Cirnigliaro2023 G
ADAM8     AU4007301chr10:
135081580-135081582
CAGCexonicMaternalframeshift deletionNM_001164490
NM_001109
c.1909_1910del
c.2104_2105del
p.L637fs
p.L702fs
-9.0E-4Cirnigliaro2023 G
ADAM8     3-0202-000chr10:
135089108-135089108
CTintronicDe novo--Trost2022 G
ADAM8     SP0117644chr10:
135081664-135081664
GGAAGGCCCTTCAAACTCAGCCCAAGCCintronicDe novo--Fu2022 E
ADAM8     SP0134751chr10:
135076600-135076600
GAUTR3De novo--Fu2022 E
ADAM8     iHART2627chr10:
135085204-135085206
CTGCexonicMaternalframeshift deletionNM_001164490
NM_001109
NM_001164489
c.993_994del
c.1110_1111del
c.1110_1111del
p.S331fs
p.S370fs
p.S370fs
-1.0E-4Ruzzo2019 G
ADAM8     mAGRE5109chr10:
135086803-135086804
GCGexonicPaternalframeshift deletionNM_001164490
NM_001109
NM_001164489
c.410delG
c.527delG
c.527delG
p.S137fs
p.S176fs
p.S176fs
--Cirnigliaro2023 G
ADAM8     mAGRE5108chr10:
135086803-135086804
GCGexonicPaternalframeshift deletionNM_001164490
NM_001109
NM_001164489
c.410delG
c.527delG
c.527delG
p.S137fs
p.S176fs
p.S176fs
--Cirnigliaro2023 G
ADAM8     mAGRE4034chr10:
135086310-135086310
CCGTGATTCTexonicMaternalframeshift insertionNM_001164490
NM_001109
NM_001164489
c.579_580insAGAATCAC
c.696_697insAGAATCAC
c.696_697insAGAATCAC
p.V194fs
p.V233fs
p.V233fs
-1.0E-4Cirnigliaro2023 G
ADAM8     SP0098944chr10:
135085306-135085306
TCintronicDe novo--Fu2022 E
Trost2022 G
Zhou2022 GE
ADAM8     AU3765302chr10:
135084254-135084254
CCTexonicDe novoframeshift insertionNM_001164490
NM_001109
NM_001164489
c.1502dupA
c.1619dupA
c.1619dupA
p.K501fs
p.K540fs
p.K540fs
--Cirnigliaro2023 G
Trost2022 G
ADAM8     11251.p1chr10:
135085034-135085034
CCGexonicDe novoframeshift insertionNM_001164490
NM_001109
NM_001164489
c.1164dupC
c.1281dupC
c.1281dupC
p.E389fs
p.E428fs
p.E428fs
-1.0E-4Wilfert2021 G
Zhou2022 GE
ADAM8     SP0007903chr10:
135087232-135087232
TAintronicDe novo--Trost2022 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More