or
or
Exact

Results for "TTC34"

Variant Events: 73

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
TTC34     AU071804chr1:
2689044-2689044
TCintronicDe novo--Yuen2017 G
TTC34     AU3649305chr1:
2628854-2628854
GCintronicDe novo--Yuen2017 G
TTC34     1-0627-004chr1:
2628421-2628421
GAintronicDe novo--Yuen2017 G
TTC34     AU4392302chr1:
2603212-2603212
CAintronicDe novo--Yuen2017 G
TTC34     1-0497-003chr1:
2932000-2932000
GAintergenicDe novo--Yuen2017 G
TTC34     1-0559-003chr1:
2790458-2790458
CTintergenicDe novo--Yuen2017 G
TTC34     2-1391-003chr1:
2907952-2907952
GCintergenicDe novo--Yuen2017 G
TTC34     SP0010083chr1:
2706220-2706220
CAUTR5De novo--Fu2022 E
TTC34     SP0075922chr1:
2700188-2700188
CTexonicDe novononsynonymous SNVNM_001242672c.G653Ap.R218Q14.42-Fu2022 E
Zhou2022 GE
TTC34     1-0530-003chr1:
2832918-2832918
GAintergenicDe novo--Yuen2016 G
Yuen2017 G
TTC34     AU1764301chr1:
2626466-2626466
CGintronicDe novo--Yuen2017 G
TTC34     AU1687302chr1:
2586308-2586371
AGACAGCCTGGAGCAGCACCCACACTCCAGGTGAGCATCTGACAGCCTGAAGCAGCACCCACACAGACAGCCTGAAGCAGCACCCACACintronicDe novo--Yuen2017 G
TTC34     AU4168306chr1:
2779690-2779690
GAintergenicDe novo--Yuen2017 G
TTC34     2-0016-003chr1:
2621438-2621438
CGintronicDe novo--Yuen2017 G
TTC34     200675615@1082034296chr1:
2572954-2572954
GAexonicDe novosynonymous SNVNM_001242672c.C1554Tp.R518R-3.0E-4Satterstrom2020 E
Trost2022 G
Zhou2022 GE
TTC34     7-0197-003chr1:
2688174-2688174
GTintronicDe novo--Yuen2017 G
TTC34     AU4426303chr1:
2615535-2615535
GAintronicDe novo--Yuen2017 G
TTC34     AU3729303chr1:
2688174-2688174
GTintronicDe novo--Yuen2017 G
TTC34     1-0244-003 Complex Event; expand row to view variants  De novo--Yuen2016 G
Yuen2017 G
TTC34     1-0627-006chr1:
2615535-2615535
GAintronicDe novo--Yuen2017 G
TTC34     4B858chr1:
2572852-2572852
CGexonicDe novononsynonymous SNVNM_001242672c.G1656Cp.K552N17.23-Fu2022 E
Satterstrom2020 E
Trost2022 G
Zhou2022 GE
TTC34     7-0171-003chr1:
2615535-2615535
GAintronicDe novo--Yuen2017 G
TTC34     AU4426303chr1:
2619240-2619240
CAintronicDe novo--Yuen2017 G
TTC34     7-0171-003chr1:
2615875-2615875
CGintronicDe novo--Yuen2017 G
TTC34     AU4426303chr1:
2628218-2628218
CGintronicDe novo--Yuen2017 G
TTC34     AU3368303chr1:
2628844-2628844
CTintronicDe novo--Yuen2017 G
TTC34     AU4426303chr1:
2628532-2628532
CTintronicDe novo--Yuen2017 G
TTC34     2-1335-004chr1:
2776178-2776178
GGGAGGAAGGAAGGAGGGAGGAAGAGGAAGGAAGGAGGGAGGAAintergenicDe novo--Yuen2017 G
TTC34     F10267-1chr1:
2577010-2577011
GAGintronicDe novo--Satterstrom2020 E
Trost2022 G
TTC34     AU4070301chr1:
2688819-2688819
GAintronicDe novo--Yuen2017 G
TTC34     AU4070301chr1:
2758907-2758907
CTintergenicDe novo--Yuen2017 G
TTC34     AU4237301chr1:
2628911-2628911
AGintronicDe novo--Yuen2017 G
TTC34     AU2089301chr1:
2730640-2730640
GCintergenicDe novo--Yuen2017 G
TTC34     AU3903301chr1:
2704695-2704695
GAintronicDe novo--Yuen2017 G
TTC34     2-0310-003chr1:
2872113-2872113
GAintergenicDe novo--Yuen2017 G
TTC34     AU1860302chr1:
2619027-2619027
CGintronicDe novo--Yuen2017 G
TTC34     AU4007302chr1:
2615635-2615635
CTintronicDe novo--Yuen2017 G
TTC34     AU3649304chr1:
2628854-2628854
GCintronicDe novo--Yuen2017 G
TTC34     AU3900302chr1:
2619655-2619655
GAintronicDe novo--Yuen2017 G
TTC34     AU060703chr1:
2622721-2622721
GAintronicDe novo--Yuen2017 G
TTC34     AU2495301chr1:
2585375-2585375
GTintronicDe novo--Yuen2017 G
TTC34     2-1497-003chr1:
2629552-2629552
GAintronicDe novo--Yuen2017 G
TTC34     AU2162302chr1:
2615569-2615569
CGintronicDe novo--Yuen2017 G
TTC34     2-1245-003chr1:
2879597-2879597
CTintergenicDe novo--Yuen2017 G
TTC34     2-1205-003chr1:
2927639-2927639
CGintergenicDe novo--Yuen2016 G
Yuen2017 G
TTC34     1-0022-004chr1:
2607041-2607041
ACintronicDe novo--Yuen2017 G
TTC34     AU075803chr1:
2689044-2689044
TCintronicDe novo--Yuen2017 G
TTC34     1-0458-005chr1:
2775760-2775760
GGGAAintergenicDe novo--Yuen2017 G
TTC34     AU3605304chr1:
2620728-2620728
CGintronicDe novo--Yuen2017 G
TTC34     2-1186-003chr1:
2585307-2585307
TCintronicDe novo--Yuen2017 G
TTC34     13825.p1chr1:
2720467-2720467
CAintergenicDe novo--Wilfert2021 G
TTC34     1-0028-003chr1:
2771610-2771610
GAintergenicDe novo--Yuen2017 G
TTC34     AU002406chr1:
2618366-2618366
CTintronicDe novo--Yuen2017 G
TTC34     AU3881301chr1:
2686498-2686498
CAintronicDe novo--Yuen2017 G
TTC34     1-0383-003chr1:
2830775-2830775
CTintergenicDe novo--Yuen2017 G
TTC34     200675615_1082034296chr1:
2572954-2572954
GAexonicDe novosynonymous SNVNM_001242672c.C1554Tp.R518R-3.0E-4Fu2022 E
TTC34     2-1186-003chr1:
2616617-2616617
TGintronicDe novo--Yuen2017 G
TTC34     2-1186-003chr1:
2585691-2585691
CAintronicDe novo--Yuen2017 G
TTC34     AU1933302chr1:
2618896-2618896
CAintronicDe novo--Yuen2017 G
TTC34     AU4234302chr1:
2585322-2585322
CAintronicDe novo--Yuen2017 G
TTC34     2-1421-003chr1:
2629552-2629552
GAintronicDe novo--Yuen2017 G
TTC34     1-0591-003chr1:
2630006-2630006
CAintronicDe novo--Yuen2017 G
TTC34     2-1591-003chr1:
2694181-2694181
CTintronicDe novo--Yuen2017 G
TTC34     2-1627-003chr1:
2780976-2780976
GAintergenicDe novo--Yuen2017 G
TTC34     2-1213-003chr1:
2615464-2615464
GAintronicDe novo--Yuen2017 G
TTC34     AU4089302chr1:
2633145-2633145
GTintronicDe novo--Yuen2017 G
TTC34     AU2139305chr1:
2615450-2615453
GACAGAintronicDe novo--Yuen2017 G
TTC34     2-1134-003chr1:
2615569-2615569
CGintronicDe novo--Yuen2017 G
TTC34     2-1134-003chr1:
2615535-2615535
GAintronicDe novo--Yuen2017 G
TTC34     AU075207chr1:
2764412-2764412
TCintergenicDe novo--Yuen2017 G
TTC34     AU4186302chr1:
2603253-2603253
CTintronicDe novo--Yuen2017 G
TTC34     1-0181-004chr1:
2813389-2813389
CTintergenicDe novo--Yuen2017 G
TTC34     AU4024303chr1:
2628934-2628934
CTintronicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More