or
or
Exact

Results for "WAC"

Variant Events: 46

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
WAC     ACGC_M12417chr10:
28903596-28903596
GAexonicPaternalnonsynonymous SNVNM_100486
NM_016628
NM_100264
c.G1229A
c.G1538A
c.G1403A
p.R410Q
p.R513Q
p.R468Q
33.0-Wang2020 T
WAC     ACGC_M15033chr10:
28897166-28897166
CTexonicPaternalnonsynonymous SNVNM_100486
NM_016628
NM_100264
c.C662T
c.C971T
c.C836T
p.T221M
p.T324M
p.T279M
22.01.647E-5Wang2020 T
WAC     SSC10854chr10:
28899668-28899672
AATTCAexonicDe novoframeshift deletionNM_100486
NM_016628
NM_100264
c.898_901del
c.1207_1210del
c.1072_1075del
p.I300fs
p.I403fs
p.I358fs
--Antaki2022 GE
Fu2022 E
WAC     ACGC_M23067chr10:
28906698-28906698
CGexonicPaternalnonsynonymous SNVNM_100486
NM_016628
NM_100264
c.C1550G
c.C1859G
c.C1724G
p.T517S
p.T620S
p.T575S
33.0-Wang2020 T
WAC     M19642chr10:
28872337-28872337
AA/GexonicMaternal--Guo2018 T
WAC     M19643chr10:
28872337-28872337
AA/GexonicMaternal--Guo2018 T
WAC     SSC10126chr10:
28879673-28879675
CAACexonicframeshift deletionNM_016628
NM_100264
NM_100486
c.523_524del
c.388_389del
c.523_524del
p.K175fs
p.K130fs
p.K175fs
--Antaki2022 GE
WAC     3-0095-000chr10:
28879726-28879736
TGCAAGCAACATexonicDe novoframeshift deletionNM_016628
NM_100264
NM_100486
c.576_585del
c.441_450del
c.576_585del
p.M192fs
p.M147fs
p.M192fs
--Tammimies2015 E
Tammimies2015 E
WAC     M10099chr10:
28884796-28884796
CC/TexonicMaternal--Guo2018 T
WAC     M23067chr10:
28906698-28906698
CGexonicUnknown, Paternalnonsynonymous SNVNM_100486
NM_016628
NM_100264
c.C1550G
c.C1859G
c.C1724G
p.T517S
p.T620S
p.T575S
33.0-Guo2018 T
Stessman2017 T
Wang2016 T
WAC     HN0181.p1chr10:
28824670-28824674
TAGAGTexonicDe novoframeshift deletionNM_016628
NM_100264
NM_100486
c.259_262del
c.124_127del
c.259_262del
p.R87fs
p.R42fs
p.R87fs
--Guo2018 T
WAC     1-0028-003 Complex Event; expand row to view variants  De novoframeshift deletionNM_100486
NM_016628
NM_100264
NM_100486
NM_016628
NM_100264
c.1163_1164del
c.1472_1473del
c.1337_1338del
c.1165_1166del
c.1474_1475del
c.1339_1340del
p.S388fs
p.S491fs
p.S446fs
p.Q389fs
p.Q492fs
p.Q447fs
--Wang2020 T
Yuen2017 G
WAC     GX0532.p1chr10:
28824677-28824678
AGAexonicDe novoframeshift deletionNM_016628
NM_100264
NM_100486
c.266delG
c.131delG
c.266delG
p.R89fs
p.R44fs
p.R89fs
--Guo2018 T
WAC     40chr10:
28824551-28824551
CTexonicDe novostopgainNM_016628
NM_100264
NM_100486
c.C139T
c.C4T
c.C139T
p.R47X
p.R2X
p.R47X
38.0-O’Roak2014 T
WAC     091-05-102949chr10:
28900807-28900807
AGexonicDe novononsynonymous SNVNM_100486
NM_016628
NM_100264
c.A1084G
c.A1393G
c.A1258G
p.I362V
p.I465V
p.I420V
15.111.648E-5Fu2022 E
Satterstrom2020 E
WAC     14200.p1chr10:
28879673-28879675
CAACexonicDe novoframeshift deletionNM_016628
NM_100264
NM_100486
c.523_524del
c.388_389del
c.523_524del
p.K175fs
p.K130fs
p.K175fs
--Iossifov2014 E
Ji2016 E
Kosmicki2017 E
O’Roak2014 T
Satterstrom2020 E
Wang2020 T
Wilfert2021 G
WAC     14204.p1chr10:
28899668-28899672
AATTCAexonicUnknown, De novoframeshift deletionNM_100486
NM_016628
NM_100264
c.898_901del
c.1207_1210del
c.1072_1075del
p.I300fs
p.I403fs
p.I358fs
--Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Satterstrom2020 E
Wang2020 T
Wilfert2021 G
WAC     ACGC_M16158chr10:
28897234-28897234
CTexonicMaternalnonsynonymous SNVNM_100486
NM_016628
NM_100264
c.C730T
c.C1039T
c.C904T
p.P244S
p.P347S
p.P302S
21.58.245E-6Wang2020 T
WAC     SAGE_228.03chr10:
28879673-28879675
CAACexonicDe novoframeshift deletionNM_016628
NM_100264
NM_100486
c.523_524del
c.388_389del
c.523_524del
p.K175fs
p.K130fs
p.K175fs
--Wang2020 T
WAC     ACGC_GX0247.p1chr10:
28824552-28824552
GAexonicMaternalnonsynonymous SNVNM_016628
NM_100264
NM_100486
c.G140A
c.G5A
c.G140A
p.R47Q
p.R2Q
p.R47Q
28.23.296E-5Wang2020 T
WAC     2-1384-003chr10:
28902775-28902775
TCintronicDe novo--Yuen2017 G
WAC     2-1140-003chr10:
28864391-28864391
GAintronicDe novo--Yuen2017 G
WAC     IGM1021chr10:
28884862-28884862
CTexonicDe novostopgainNM_016628
NM_100264
c.C811T
c.C676T
p.Q271X
p.Q226X
40.0-Fu2022 E
Satterstrom2020 E
WAC     M16158 Complex Event; expand row to view variants  Maternal, Unknownnonsynonymous SNVNM_100486
NM_016628
NM_100264
c.C730T
c.C1039T
c.C904T
p.P244S
p.P347S
p.P302S
21.58.245E-6Guo2018 T
Stessman2017 T
WAC     M12417chr10:
28903596-28903596
GAexonicPaternalnonsynonymous SNVNM_100486
NM_016628
NM_100264
c.G1229A
c.G1538A
c.G1403A
p.R410Q
p.R513Q
p.R468Q
33.0-Guo2018 T
Wang2016 T
Wang2016 T
WAC     1-0045-003chr10:
28944041-28944041
TTCCCTCTGCCCGGCCGCCCCTACTGGGAAGTGAGGAGCintergenicDe novo--Yuen2017 G
WAC     SP0102345chr10:
28824691-28824691
GCintronicDe novo--Fu2022 E
WAC     1-0632-003chr10:
28944041-28944041
TTCCCTCTGCCCGGCCGCCCCTACTGGGAAGTGAGGAGCintergenicDe novo--Yuen2017 G
WAC     HN0172.p1chr10:
28897340-28897340
AA/GexonicMaternal--Guo2018 T
WAC     M15033chr10:
28897166-28897166
CC/TexonicPaternal--Guo2018 T
WAC     GX0414.p1chr10:
28824533-28824533
CA/CexonicPaternal--Guo2018 T
WAC     ACGC_M8973chr10:
28897273-28897273
CAexonicUnknownnonsynonymous SNVNM_100486
NM_016628
NM_100264
c.C769A
c.C1078A
c.C943A
p.P257T
p.P360T
p.P315T
27.0-Wang2020 T
WAC     AGRE_AU057904chr10:
28878776-28878776
GAexonicUnknownnonsynonymous SNVNM_016628
NM_100264
NM_100486
c.G493A
c.G358A
c.G493A
p.E165K
p.E120K
p.E165K
36.0-Wang2020 T
WAC     AU057904chr10:
28878776-28878776
GAexonicUnknownnonsynonymous SNVNM_016628
NM_100264
NM_100486
c.G493A
c.G358A
c.G493A
p.E165K
p.E120K
p.E165K
36.0-Stessman2017 T
WAC     1-0446-003chr10:
28937317-28937317
GGTATCintergenicDe novo--Yuen2017 G
WAC     2-1562-003chr10:
28944041-28944041
TTCCCTCTGCCCGGCCGCCCCTACTGGGAAGTGAGGAGCintergenicDe novo--Yuen2017 G
WAC     5-0014-003chr10:
28852532-28852532
GAintronicDe novo--Yuen2017 G
WAC     GX0247.p1chr10:
28824552-28824552
GA/GexonicMaternal--Guo2018 T
WAC     GX0345.p1chr10:
28879758-28879758
GA/GexonicPaternal--Guo2018 T
WAC     ACGC_GX0532.p1 Complex Event; expand row to view variants  Unknown, De novoframeshift deletion, frameshift substitutionNM_016628
NM_100264
NM_100486
NM_016628
NM_100264
NM_100486
c.266delG
c.131delG
c.266delG
c.267_268T
c.132_133T
c.267_268T
p.R89fs
p.R44fs
p.R89fs
N/A
N/A
N/A
--Wang2020 T
Wang2020 T
WAC     36034chr10:
28879673-28879675
CAACexonicDe novoframeshift deletionNM_016628
NM_100264
NM_100486
c.523_524del
c.388_389del
c.523_524del
p.K175fs
p.K130fs
p.K175fs
--Fu2022 E
WAC     HN0009.p2chr10:
28879722-28879722
GA/GexonicPaternal--Guo2018 T
WAC     ACGC_HN0181.p1chr10:
28824670-28824674
TAGAGTexonicDe novoframeshift deletionNM_016628
NM_100264
NM_100486
c.259_262del
c.124_127del
c.259_262del
p.R87fs
p.R42fs
p.R87fs
--Wang2020 T
WAC     GX0213.p1chr10:
28906595-28906595
TA/TexonicPaternal--Guo2018 T
WAC     M30327chr10:
28899675-28899675
AA/CexonicPaternal--Guo2018 T
WAC     GEA354chr10:
28908482-28908482
CTexonicDe novostopgainNM_100486
NM_016628
NM_100264
c.C1582T
c.C1891T
c.C1756T
p.Q528X
p.Q631X
p.Q586X
42.0-Fu2022 E
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More