or
or
Exact

Results for "SEMG2"

Variant Events: 10

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
SEMG2     SP0003494chr20:
43851022-43851022
CTexonicMosaicnonsynonymous SNVNM_003008c.C749Tp.P250L0.4515.794E-5Feliciano2019 E
SEMG2     1-0150-004chr20:
43857674-43857674
TCintergenicDe novo--Yuen2017 G
SEMG2     11818.p1chr20:
43859486-43859486
GAintergenicDe novo--Werling2018 G
SEMG2     2-1296-003chr20:
43873279-43873291
GTATATATATATAGTATATATATAintergenicDe novo--Yuen2017 G
SEMG2     AU3891303chr20:
43858431-43858431
GCintergenicDe novo--Yuen2017 G
SEMG2     iHART1357chr20:
43851936-43851941
AATATTAexonicMaternalframeshift deletionNM_003008c.1664_1668delp.N555fs--Ruzzo2019 G
SEMG2     09C81574chr20:
43851703-43851703
GAexonicDe novononsynonymous SNVNM_003008c.G1430Ap.R477Q3.24-DeRubeis2014 E
Kosmicki2017 E
Lim2017 E
Satterstrom2020 E
SEMG2     iHART1356chr20:
43851936-43851941
AATATTAexonicMaternalframeshift deletionNM_003008c.1664_1668delp.N555fs--Ruzzo2019 G
SEMG2     Al-Mubarak2017:ASD-66chr20:
43850773-43850773
GAexonicUnknownstopgainNM_003008c.G500Ap.W167X10.048.241E-6Al-Mubarak2017 E
SEMG2     200675428@1082034664chr20:
43850315-43850315
TCintronicDe novo--Satterstrom2020 E
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More