or
or
Exact

Results for "EPAS1"

Variant Events: 18

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
EPAS1     7-0059-003chr2:
46561390-46561390
GTintronicDe novo--Yuen2017 G
EPAS1     AU4079301chr2:
46620604-46620604
TCintergenicDe novo--Yuen2017 G
EPAS1     2-1127-003chr2:
46584144-46584144
CTintronicDe novo--Yuen2016 G
Yuen2017 G
EPAS1     111299chr2:
46603835-46603835
GAexonicnonsynonymous SNVNM_001430c.G1192Ap.E398K36.0-Woodbury-Smith2022 E
EPAS1     AU008505chr2:
46617380-46617380
CTintergenicDe novo--Yuen2017 G
EPAS1     ASDFI_974chr2:
46583448-46583448
CTintronicDe novo-8.242E-6Satterstrom2020 E
EPAS1     AU4199303chr2:
46608778-46608778
CGexonicDe novononsynonymous SNVNM_001430c.C2089Gp.P697A15.55-Yuen2017 G
EPAS1     2-1261-003chr2:
46652429-46652429
AATCCintergenicDe novo--Yuen2017 G
EPAS1     1-0826-003chr2:
46638701-46638701
GAintergenicDe novo--Yuen2017 G
EPAS1     2-1619-003chr2:
46538259-46538259
ACintronicDe novo--Yuen2017 G
EPAS1     AU030804chr2:
46596629-46596629
GTintronicDe novo--Yuen2017 G
EPAS1     14641.p1chr2:
46603670-46603670
CTintronicDe novo-1.647E-5Iossifov2014 E
Kosmicki2017 E
Satterstrom2020 E
EPAS1     2-1497-003chr2:
46523969-46523969
GAupstreamDe novo--Yuen2017 G
EPAS1     12290.p1chr2:
46607706-46607706
GAexonicDe novononsynonymous SNVNM_001430c.G1895Ap.G632E21.9-Satterstrom2020 E
EPAS1     09C95233chr2:
46607903-46607903
CTintronicDe novo--Satterstrom2020 E
EPAS1     3-0442-000chr2:
46565552-46565552
TCintronicDe novo--Yuen2016 G
Yuen2017 G
EPAS1     35.s1chr2:
46597010-46597010
GAexonicDe novononsynonymous SNVNM_001430c.G824Ap.R275H28.79.263E-6An2014 E
EPAS1     2-1239-003chr2:
46598623-46598636
GACACACACACACAGACACACACACAintronicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More