or
or
Exact

Results for "RBM27"

Variant Events: 15

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
RBM27       SSC07063chr5:
145613205-145613205
GAexonicDe novononsynonymous SNVNM_018989c.G1043Ap.G348D17.39-Lim2017 E
RBM27       2-1066-003chr5:
145689528-145689528
TGintergenicDe novo--Yuen2017 G
RBM27       12497.p1chr5:
145603023-145603023
CTexonicDe novononsynonymous SNVNM_018989c.C236Tp.P79L19.02-Ji2016 E
Krumm2015 E
Satterstrom2020 E
Wilfert2021 G
RBM27       SSC06431chr5:
145603023-145603023
CTexonicDe novononsynonymous SNVNM_018989c.C236Tp.P79L19.02-Lim2017 E
RBM27       Kim2020:B26chr5:
145613207-145613207
CAexonicDe novononsynonymous SNVNM_018989c.C1045Ap.P349T18.0-Kim2020 E
RBM27       08C75913chr5:
145583405-145583405
GTintronicDe novo--Satterstrom2020 E
RBM27       2-0036-003chr5:
145636507-145636511
CTATTCintronicDe novo--Yuen2016 G
RBM27       2-0016-003chr5:
145636507-145636513
CTATTTACTAintronicDe novo--Yuen2017 G
RBM27       2-0244-003chr5:
145689528-145689528
TGintergenicDe novo--Yuen2017 G
RBM27       2-1291-003chr5:
145603808-145603822
GTATATATATATATAGTATATATATATAintronicDe novo--Yuen2017 G
RBM27       AU3680301chr5:
145661811-145661811
CTintronicDe novo--Yuen2017 G
RBM27       13942.p1chr5:
145598302-145598302
CGintronicDe novo--Turner2016 G
RBM27       13096.p1chr5:
145613205-145613205
GAexonicDe novononsynonymous SNVNM_018989c.G1043Ap.G348D17.39-Iossifov2012 E
Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Satterstrom2020 E
Wilfert2021 G
RBM27       2-0320-003chr5:
145629605-145629605
AGintronicDe novo--Yuen2017 G
RBM27       AU1308303chr5:
145638859-145638861
ACTAintronicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More