or
or
Exact

Results for "KSR2"

Variant Events: 27

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
KSR2     13825.p1chr12:
118122627-118122627
TCintronicDe novo--Wilfert2021 G
KSR2     1-0186-004chr12:
118095925-118095925
GAintronicDe novo--Yuen2017 G
KSR2     2-1409-003chr12:
118019249-118019249
ACintronicDe novo--Yuen2016 G
Yuen2017 G
KSR2     2-1690-003chr12:
118376934-118376934
ACintronicDe novo--Yuen2017 G
KSR2     AU063004chr12:
118068497-118068497
ATintronicDe novo--Yuen2017 G
KSR2     2-0132-004chr12:
118181340-118181340
CTintronicDe novo--Yuen2017 G
KSR2     AU0786305chr12:
118128038-118128038
GCintronicDe novo--Yuen2017 G
KSR2     AU4239301chr12:
118021390-118021392
CTTCintronicDe novo--Yuen2017 G
KSR2     1-0303-003chr12:
118107119-118107120
TATintronicDe novo--Yuen2017 G
KSR2     AU006804chr12:
117987784-117987785
CACintronicDe novo--Yuen2017 G
KSR2     AU3761302chr12:
118165367-118165367
GAintronicDe novo--Yuen2017 G
KSR2     1-0494-003Achr12:
117931993-117931993
CTintronicDe novo--Yuen2017 G
KSR2     16.s1chr12:
117922337-117922337
GTexonicDe novononsynonymous SNVNM_173598c.C2247Ap.H749Q17.65-An2014 E
KSR2     2-1315-003chr12:
118097041-118097041
CGintronicDe novo--Yuen2016 G
Yuen2017 G
KSR2     AU3911301chr12:
118014629-118014645
TTGTGTGTGTGTGTGTGTTGTGTGTGTGTGTGTGTGintronicDe novo--Yuen2017 G
KSR2     AU2075302chr12:
118143148-118143148
CGintronicDe novo--Yuen2017 G
KSR2     1-0257-003chr12:
118372787-118372787
CTintronicDe novo--Yuen2017 G
KSR2     7-0141-003chr12:
118152243-118152243
CGintronicDe novo--Yuen2017 G
KSR2     AU4056301chr12:
118452210-118452210
GCintergenicDe novo--Yuen2017 G
KSR2     1-0579-003chr12:
118150935-118150949
CTAGATAGATAGATACTAGATAGATAintronicDe novo--Yuen2017 G
KSR2     AU1521301chr12:
118431651-118431651
AGintergenicDe novo--Yuen2017 G
KSR2     1-0494-003chr12:
117931993-117931993
CTintronicDe novo--Yuen2017 G
KSR2     5-0041-003chr12:
118309449-118309449
GCintronicDe novo--Yuen2017 G
KSR2     AU2437302chr12:
118370555-118370555
CTintronicDe novo--Yuen2017 G
KSR2     AU3874301chr12:
118149669-118149669
TCintronicDe novo--Yuen2017 G
KSR2     AU4150301chr12:
118151402-118151402
AGintronicDe novo--Yuen2017 G
KSR2     AU3154302chr12:
117957358-117957358
GAintronicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More