or
or
Exact

Results for "GSPT1"

Variant Events: 29

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
GSPT1     1-0632-003chr16:
12048384-12048384
GAintergenicDe novo--Yuen2017 G
GSPT1     7-0078-003chr16:
12019516-12019516
GTintergenicDe novo--Yuen2017 G
GSPT1     AU009805chr16:
12039026-12039026
AGintergenicDe novo--Yuen2017 G
GSPT1     SSC10147chr16:
11991784-11991784
TAintronicDe novo--Trost2022 G
GSPT1     1-1165-003chr16:
12001328-12001329
TATintronicDe novo--Trost2022 G
GSPT1     SP0185311chr16:
11980779-11980779
CTexonicDe novononsynonymous SNVNM_001130006
NM_001130007
NM_002094
c.G964A
c.G553A
c.G967A
p.A322T
p.A185T
p.A323T
32.0-Trost2022 G
GSPT1     2-1287-003chr16:
11984117-11984117
TAintronicDe novo--Trost2022 G
GSPT1     12680.p1chr16:
11977582-11977582
CTintronicDe novo--Turner2016 G
GSPT1     3-0787-000chr16:
11968939-11968939
GAintronicDe novo--Trost2022 G
GSPT1     12680.p1chr16:
11977587-11977587
TCintronicDe novo--Turner2016 G
GSPT1     MT_89.3chr16:
11976428-11976430
CTGCintronicDe novo--Trost2022 G
GSPT1     12680.p1chr16:
11977567-11977567
CTintronicDe novo--Turner2016 G
GSPT1     12680.p1chr16:
11977571-11977571
CAintronicDe novo--Turner2016 G
GSPT1     2-1146-003chr16:
11994856-11994883
GAAAAACAAAAAACAAAAAACAAAAAACGAAAAACAAAAAACAAAAAACintronicDe novo--Yuen2017 G
GSPT1     12680.p1chr16:
11977591-11977591
GAintronicDe novo--Turner2016 G
GSPT1     12680.p1chr16:
11977598-11977598
CTintronicDe novo--Turner2016 G
GSPT1     13259.p1chr16:
11991784-11991784
TAintronicDe novo--Iossifov2014 E
Kosmicki2017 E
Satterstrom2020 E
GSPT1     1-0009-004chr16:
11997197-11997197
GAintronicDe novo--Yuen2017 G
GSPT1     2-1169-003chr16:
12009007-12009007
GGGCGCGCTintronicDe novo--Yuen2017 G
GSPT1     AU3903302 Complex Event; expand row to view variants  De novo--Yuen2017 G
Yuen2017 G
GSPT1     Marques2022:78chr16:
11970019-11970019
TCexonicnonsynonymous SNVNM_001130006
NM_001130007
NM_002094
c.A1613G
c.A1202G
c.A1616G
p.E538G
p.E401G
p.E539G
23.8-Marques2022 ET
GSPT1     Marques2022:77chr16:
11969662-11969662
AGexonicnonsynonymous SNVNM_001130006
NM_001130007
NM_002094
c.T1814C
c.T1403C
c.T1817C
p.F605S
p.F468S
p.F606S
22.7-Marques2022 ET
GSPT1     Marques2022:80chr16:
11980731-11980731
TCexonicnonsynonymous SNVNM_001130006
NM_001130007
NM_002094
c.A1012G
c.A601G
c.A1015G
p.R338G
p.R201G
p.R339G
19.63-Marques2022 ET
GSPT1     Marques2022:79chr16:
11976936-11976936
ATexonicnonsynonymous SNVNM_001130006
NM_001130007
NM_002094
c.T1361A
c.T950A
c.T1364A
p.V454D
p.V317D
p.V455D
25.1-Marques2022 ET
GSPT1     607966716413-C2chr16:
12035923-12035923
CTintergenicDe novo--Fu2022 E
GSPT1     1-0565-004chr16:
12002578-12002578
CGintronicDe novo--Yuen2017 G
GSPT1     AU3912303chr16:
11974804-11974804
GAintronicDe novo--Trost2022 G
Yuen2017 G
GSPT1     SP0036521chr16:
11980445-11980445
ATexonicDe novononsynonymous SNVNM_001130006
NM_001130007
NM_002094
c.T1133A
c.T722A
c.T1136A
p.L378Q
p.L241Q
p.L379Q
20.8-Antaki2022 GE
Fu2022 E
Zhou2022 GE
GSPT1     MR_1483chr16:
12021335-12021335
TGintergenicDe novo--Fu2022 E
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More