or
or
Exact

Results for "BTAF1"

Variant Events: 15

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
BTAF1     2-1511-003chr10:
93693333-93693333
GAintronicDe novo--Yuen2017 G
BTAF1     1-0292-005chr10:
93716323-93716323
GAexonicDe novononsynonymous SNVNM_003972c.G740Ap.R247Q21.9-Yuen2015 G
Yuen2017 G
BTAF1     11025.p1chr10:
93723820-93723851
AACTGATCTTATAGGTGCCCTTCATTATAAATAexonicDe novononframeshift deletionNM_003972c.1405_1422delp.469_474del--Wilfert2021 G
BTAF1     7-0255-003chr10:
93801554-93801554
TCintergenicDe novo--Yuen2017 G
BTAF1     03HI2710Achr10:
93740209-93740209
ATsplicingsplicing19.642.689E-5Doan2019 E
BTAF1     G01-GEA-301-HIchr10:
93767924-93767924
AGexonicDe novosynonymous SNVNM_003972c.A3705Gp.Q1235Q--Satterstrom2020 E
BTAF1     152430chr10:
93753608-93753608
TCintronicDe novo--Satterstrom2020 E
BTAF1     1-0181-004chr10:
93700658-93700658
GAintronicDe novo--Yuen2017 G
BTAF1     1-0126-003chr10:
93762226-93762226
GTintronicDe novo--Yuen2017 G
BTAF1     11025.p1chr10:
93723898-93723899
CACexonicDe novoframeshift deletionNM_003972c.1470delAp.T490fs--Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Satterstrom2020 E
Wilfert2021 G
BTAF1     SP0032561chr10:
93744130-93744130
AGexonicDe novononsynonymous SNVNM_003972c.A2396Gp.N799S0.1761.913E-5Feliciano2019 E
BTAF1     11946.p1chr10:
93776242-93776242
TCintronicDe novo--Iossifov2014 E
Kosmicki2017 E
BTAF1     11555.p1chr10:
93784493-93784493
TTTTTGintronicDe novo-1.762E-5Krumm2015 E
BTAF1     1-0346-004chr10:
93693938-93693938
GAintronicDe novo--Yuen2017 G
BTAF1     03HI2710Achr10:
93756124-93756124
ATsplicingsplicing21.71.0E-4Doan2019 E
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More