or
or
Exact

Results for "USH2A"

Variant Events: 55

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
USH2A     09C82560chr1:
216074296-216074296
TCintronicDe novo--Kosmicki2017 E
Satterstrom2020 E
USH2A     2-1066-004chr1:
216418105-216418105
GTintronicDe novo--Yuen2017 G
USH2A     2-1382-003chr1:
215861604-215861604
GAintronicDe novo--Yuen2017 G
USH2A     2-1306-004chr1:
216350942-216350942
GGGAGCintronicDe novo--Yuen2017 G
USH2A     1-0339-003chr1:
215823845-215823845
GAintronicDe novo--Yuen2017 G
USH2A     2-1295-003chr1:
216314149-216314149
CGintronicDe novo--Yuen2016 G
Yuen2017 G
USH2A     AU065304chr1:
216351596-216351596
TCintronicDe novo--Yuen2017 G
USH2A     AU4122301chr1:
216388814-216388814
GCintronicDe novo--Yuen2017 G
USH2A     1-0551-003chr1:
216031326-216031326
TGintronicDe novo--Yuen2017 G
USH2A     1-0675-003chr1:
215897178-215897178
CTintronicDe novo--Yuen2017 G
USH2A     1-0347-003chr1:
216492872-216492872
CAintronicDe novo--Yuen2017 G
USH2A     2-1306-003chr1:
216350942-216350942
GGGAGCintronicDe novo--Yuen2017 G
USH2A     12600.p1chr1:
216011431-216011431
TCexonicDe novosynonymous SNVNM_206933c.A9273Gp.T3091T--Iossifov2014 E
Kosmicki2017 E
Krupp2017 E
Lim2017 E
Satterstrom2020 E
Wilfert2021 G
USH2A     AU3646301chr1:
216315906-216315906
GAintronicDe novo--Yuen2017 G
USH2A     11897.p1chr1:
216062348-216062348
ACexonicDe novononsynonymous SNVNM_206933c.T7643Gp.M2548R13.06-Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Krupp2017 E
Lim2017 E
Satterstrom2020 E
Wilfert2021 G
USH2A     09C87038chr1:
216363573-216363573
AGexonicDe novononsynonymous SNVNM_007123
NM_206933
c.T4388C
c.T4388C
p.L1463S
p.L1463S
12.03-DeRubeis2014 E
Kosmicki2017 E
Lim2017 E
Neale2012 E
Satterstrom2020 E
USH2A     13130.p1chr1:
216495331-216495331
GAintronicDe novo--Iossifov2014 E
Kosmicki2017 E
Satterstrom2020 E
USH2A     7-0133-003chr1:
216103707-216103726
TAACAAAGACAGTTTCAGACTintronicDe novo--Yuen2017 G
USH2A     13641.p1chr1:
216073502-216073502
GTexonicDe novostopgainNM_206933c.C7509Ap.Y2503X51.0-Ji2016 E
USH2A     5-0088-003chr1:
216064897-216064897
CAintronicDe novo--Yuen2017 G
USH2A     AU2137304chr1:
216380781-216380781
AGintronicDe novo--Yuen2017 G
USH2A     AU4426303chr1:
216101160-216101160
CTintronicDe novo--Yuen2017 G
USH2A     AU072904chr1:
216175271-216175271
TAintronicDe novo--Yuen2017 G
USH2A     1-0405-003chr1:
216205978-216205978
CTintronicDe novo--Yuen2017 G
USH2A     2-1323-003chr1:
216666293-216666293
TCintergenicDe novo--Yuen2016 G
Yuen2017 G
USH2A     AU3632301chr1:
216624125-216624125
GAintergenicDe novo--Yuen2017 G
USH2A     Lim2017:35873chr1:
215963541-215963541
TGexonicDe novononsynonymous SNVNM_206933c.A10042Cp.I3348L12.12-Lim2017 E
USH2A     344-05-104641chr1:
216591942-216591942
GAexonicDe novononsynonymous SNVNM_007123
NM_206933
c.C565T
c.C565T
p.R189C
p.R189C
24.22.477E-5Satterstrom2020 E
USH2A     1-0257-003chr1:
216625513-216625513
CTintergenicDe novo--Yuen2017 G
USH2A     2-1386-003chr1:
216098596-216098596
CTintronicDe novo--Yuen2016 G
Yuen2017 G
USH2A     2-1427-003chr1:
216189649-216189649
CAintronicDe novo--Yuen2017 G
USH2A     1-0244-003chr1:
215949010-215949010
CGintronicDe novo--Yuen2016 G
Yuen2017 G
USH2A     1-0244-003chr1:
215949045-215949045
ATintronicDe novo--Yuen2016 G
Yuen2017 G
USH2A     13171.p1chr1:
215810853-215810853
TCintronicDe novo--Turner2016 G
USH2A     11572.p1chr1:
215963541-215963541
TGexonicMosaic, De novononsynonymous SNVNM_206933c.A10042Cp.I3348L12.12-Dou2017 E
Ji2016 E
Turner2016 G
USH2A     1-0209-003chr1:
216158424-216158424
GAintronicDe novo--Yuen2017 G
USH2A     AU3861303chr1:
215971483-215971483
ATintronicDe novo--Yuen2017 G
USH2A     AU4378301chr1:
216371765-216371765
TCexonicDe novononsynonymous SNVNM_007123
NM_206933
c.A3973G
c.A3973G
p.T1325A
p.T1325A
9.479-Yuen2017 G
USH2A     AU3861303chr1:
215968678-215968678
GTintronicDe novo--Yuen2017 G
USH2A     AU3760301chr1:
215995239-215995239
GAintronicDe novo--Yuen2017 G
USH2A     5-0025-004chr1:
215941421-215941421
GAintronicDe novo--Yuen2017 G
USH2A     2-0214-003chr1:
216224103-216224103
CTintronicDe novo--Yuen2017 G
USH2A     iHART2091chr1:
215955527-215955527
AAATexonicMaternalframeshift insertionNM_206933c.10596_10597insATp.Y3533fs--Ruzzo2019 G
USH2A     09C96107chr1:
215848539-215848539
ACexonicstopgainNM_206933c.T12714Gp.Y4238X55.0-Doan2019 E
Doan2019 E
USH2A     1-0265-004chr1:
216208508-216208510
TAGTintronicDe novo--Yuen2017 G
USH2A     2-1605-003chr1:
215919489-215919489
CTintronicDe novo--Yuen2017 G
USH2A     2-0144-004chr1:
216225859-216225859
TCintronicDe novo--Yuen2017 G
USH2A     iHART2274chr1:
216420436-216420437
TCTexonicMaternalframeshift deletionNM_007123
NM_206933
c.2299delG
c.2299delG
p.E767fs
p.E767fs
-8.0E-4Ruzzo2019 G
USH2A     iHART2272chr1:
216420436-216420437
TCTexonicMaternalframeshift deletionNM_007123
NM_206933
c.2299delG
c.2299delG
p.E767fs
p.E767fs
-8.0E-4Ruzzo2019 G
USH2A     09C96107chr1:
216219874-216219874
CTexonicstopgainNM_206933c.G6224Ap.W2075X50.0-Doan2019 E
Doan2019 E
USH2A     2-1329-003chr1:
215951779-215951779
GAintronicDe novo--Yuen2016 G
Yuen2017 G
USH2A     1-0329-003chr1:
215858118-215858118
CGintronicDe novo--Yuen2017 G
USH2A     1-0804-003chr1:
216568271-216568271
AGintronicDe novo--Yuen2017 G
USH2A     2-0273-003chr1:
215962962-215962962
ATintronicDe novo--Yuen2017 G
USH2A     1-0052-004chr1:
216492382-216492382
ACintronicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More