or
or
Exact

Results for "PAH"

Variant Events: 31

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
PAH     1-0010-005chr12:
103339792-103339792
GAintergenicDe novo--Yuen2017 G
PAH     NDAR_INVZW891AN2_wes1chr12:
103248917-103248917
GAexonicstopgainNM_000277c.C703Tp.Q235X38.0-Doan2019 E
PAH     PN400115chr12:
103234271-103234271
GAexonicUnknownnonsynonymous SNVNM_000277c.C1222Tp.R408W19.027.0E-4Leblond2019 E
PAH     PN400108chr12:
103234271-103234271
GAexonicUnknownnonsynonymous SNVNM_000277c.C1222Tp.R408W19.027.0E-4Leblond2019 E
PAH     13695.p1chr12:
103232983-103232983
GAexonicDe novosynonymous SNVNM_000277c.C1329Tp.I443I--Iossifov2014 E
Kosmicki2017 E
Satterstrom2020 E
PAH     PN400289chr12:
103234271-103234271
GAexonicUnknownnonsynonymous SNVNM_000277c.C1222Tp.R408W19.027.0E-4Leblond2019 E
PAH     2-1318-004chr12:
103292681-103292681
TCintronicDe novo--Yuen2017 G
PAH     iHART2193chr12:
103246621-103246621
CAexonicPaternalstopgainNM_000277c.G814Tp.G272X42.03.295E-5Ruzzo2019 G
PAH     iHART2442chr12:
103246654-103246654
GAexonicMaternalstopgainNM_000277c.C781Tp.R261X43.08.239E-6Ruzzo2019 G
PAH     iHART2195chr12:
103246621-103246621
CAexonicPaternalstopgainNM_000277c.G814Tp.G272X42.03.295E-5Ruzzo2019 G
PAH     PN400489chr12:
103234271-103234271
GAexonicUnknownnonsynonymous SNVNM_000277c.C1222Tp.R408W19.027.0E-4Leblond2019 E
PAH     AU-16201chr12:
103246593-103246593
GAexonicnonsynonymous SNVNM_000277c.C842Tp.P281L27.19.884E-5Doan2019 E
PAH     AU-16201chr12:
103246653-103246653
CTexonicnonsynonymous SNVNM_000277c.G782Ap.R261Q36.03.0E-4Doan2019 E
PAH     AU-13100chr12:
103249007-103249028
CATAGCAAGCATGGGTTTTATACexonicInheritednonframeshift deletionNM_000277c.592_612delp.198_204del--Yu2013 E
PAH     1-0708-003chr12:
103334506-103334506
CTintergenicDe novo--Yuen2017 G
PAH     AU-4100chr12:
103248917-103248917
GAexonicInheritedstopgainNM_000277c.C703Tp.Q235X38.0-Yu2013 E
PAH     2-0319-004chr12:
103288718-103288718
GAintronicDe novo--Yuen2017 G
PAH     04C35712chr12:
103288718-103288718
GAintronicDe novo--Satterstrom2020 E
PAH     SSC08088chr12:
103232983-103232983
GAexonicDe novosynonymous SNVNM_000277c.C1329Tp.I443I--Lim2017 E
PAH     PN400330chr12:
103234271-103234271
GAexonicUnknownnonsynonymous SNVNM_000277c.C1222Tp.R408W19.027.0E-4Leblond2019 E
PAH     A6chr12:
103338195-103338195
TGintergenicDe novo--Wu2018 G
PAH     7-0256-003chr12:
103274958-103274963
ATTTTTATTTTintronicDe novo--Yuen2017 G
PAH     PN400215chr12:
103234271-103234271
GAexonicUnknownnonsynonymous SNVNM_000277c.C1222Tp.R408W19.027.0E-4Leblond2019 E
PAH     1-0826-003chr12:
103322301-103322301
GAintergenicDe novo--Yuen2017 G
PAH     1-0007-003chr12:
103280224-103280227
AAGAAAGAGAintronicDe novo--Yuen2017 G
PAH     1-0153-005chr12:
103300628-103300628
TCintronicDe novo--Yuen2017 G
PAH     1-0006-003chr12:
103304476-103304476
ATintronicDe novo--Yuen2017 G
PAH     PN400171chr12:
103234271-103234271
GAexonicUnknownnonsynonymous SNVNM_000277c.C1222Tp.R408W19.027.0E-4Leblond2019 E
PAH     NDAR_INVBX440FDB_wes1chr12:
103248917-103248917
GAexonicstopgainNM_000277c.C703Tp.Q235X38.0-Doan2019 E
PAH     PN400391chr12:
103234271-103234271
GAexonicUnknownnonsynonymous SNVNM_000277c.C1222Tp.R408W19.027.0E-4Leblond2019 E
PAH     AU3900302chr12:
103289648-103289649
ATAintronicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More