or
or
Exact

Results for "ATP9B"

Variant Events: 29

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
ATP9B     7-0256-003chr18:
77106427-77106427
GAintronicDe novo--Yuen2017 G
ATP9B     iHART2777chr18:
77104264-77104264
GAsplicingMaternalsplicing12.42-Ruzzo2019 G
ATP9B     03HI2710Achr18:
76873279-76873279
TGexonicstopgainNM_001306085
NM_198531
c.T483G
c.T483G
p.Y161X
p.Y161X
32.0-Doan2019 E
ATP9B     iHART1647chr18:
76873279-76873279
TGexonicPaternalstopgainNM_001306085
NM_198531
c.T483G
c.T483G
p.Y161X
p.Y161X
32.0-Ruzzo2019 G
ATP9B     03HI2710Achr18:
76886265-76886265
ATsplicingsplicing22.92.474E-5Doan2019 E
ATP9B     5-0106-003chr18:
77142201-77142201
AGintergenicDe novo--Yuen2017 G
ATP9B     PN400313chr18:
77096646-77096646
GCexonicUnknownnonsynonymous SNVNM_001306085
NM_198531
c.G2047C
c.G2047C
p.E683Q
p.E683Q
23.83.0E-4Leblond2019 E
ATP9B     PN400379chr18:
77037137-77037137
GAexonicUnknownnonsynonymous SNVNM_001306085
NM_198531
c.G1352A
c.G1352A
p.R451Q
p.R451Q
34.02.471E-5Leblond2019 E
ATP9B     1-0233-004chr18:
76960779-76960779
AAGGCGGAGGTGGGAACTGTCGGGGTCAGintronicDe novo--Yuen2017 G
ATP9B     1-0563-004chr18:
76960735-76960735
GGGGTCAGAGCAGAGGTGGAGGTGGGAACTGTCATintronicDe novo--Yuen2017 G
ATP9B     AU3506303chr18:
76964998-76964998
CTintronicDe novo--Yuen2017 G
ATP9B     1-0566-003chr18:
76972095-76972095
CAintronicDe novo--Yuen2017 G
ATP9B     2-1722-003chr18:
76965328-76965328
TCintronicDe novo--Yuen2017 G
ATP9B     2-1722-003chr18:
76965346-76965346
CTintronicDe novo--Yuen2017 G
ATP9B     2-0318-004chr18:
76916829-76916829
AAGGCTGCCintronicDe novo--Yuen2017 G
ATP9B     2-1250-003chr18:
76960779-76960779
AAGGCGGAGGTGGGAACTGTCGGGGTCAGintronicDe novo--Yuen2017 G
ATP9B     2-1620-004chr18:
76960733-76960733
CCAGGGTCAGAGCAGAGGCGGAGGTGGGAACGTTintronicDe novo--Yuen2017 G
ATP9B     1-0045-004chr18:
76960779-76960779
AAGGTGGAGGTGGGGACTGTCGGGGTCAGintronicDe novo--Yuen2017 G
ATP9B     5-0074-003chr18:
77094582-77094582
GTintronicDe novo--Yuen2017 G
ATP9B     2-1505-004chr18:
76960734-76960734
GGGGGTCAGAGCAGAGGCGGAGGTGGGGACTGTCGGGGTCAGAGCAGAGGTGGAGGTGGGAACTGTCAintronicDe novo--Yuen2017 G
ATP9B     AU2410302chr18:
77123385-77123385
GCintronicDe novo--Yuen2017 G
ATP9B     2-0289-004chr18:
76960734-76960734
GGGGGTCAGAGCAGAGGCGGAGGTGGGGACTGTCGGGGTCAGAGCAGAGGTGGAGGTGGGAACTGTCAintronicDe novo--Yuen2017 G
ATP9B     AU2000302chr18:
77054408-77054408
CTintronicDe novo--Yuen2017 G
ATP9B     AU2787301chr18:
76995617-76995617
GAintronicDe novo--Yuen2017 G
ATP9B     2-1334-003chr18:
76873551-76873551
CAintronicDe novo--Yuen2016 G
Yuen2017 G
ATP9B     2-1359-003chr18:
77102379-77102379
CTintronicDe novo-0.0022Yuen2017 G
ATP9B     1-0208-003chr18:
77095254-77095254
CTintronicDe novo--Yuen2017 G
ATP9B     60-2027chr18:
76882806-76882806
AGintronicDe novo--Michaelson2012 G
ATP9B     1-0455-004chr18:
76960733-76960733
CCGGGGTCAGAGCAGAGGCGGAGGTGGGAACGTTintronicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More