or
or
Exact

Results for "GBE1"

Variant Events: 118

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
GBE1     2-0057-003chr3:
83006174-83006174
TCintergenicDe novo--Yuen2017 G
GBE1     AU3124304chr3:
82497661-82497661
TCintergenicDe novo--Yuen2017 G
GBE1     AU4150301chr3:
82560818-82560819
CACAAintergenicDe novo--Yuen2017 G
GBE1     AU0780301chr3:
83279518-83279518
TCintergenicDe novo--Yuen2017 G
GBE1     5-0050-004chr3:
81590823-81590823
TAintronicDe novo--Yuen2017 G
GBE1     AU024607chr3:
83347487-83347487
GAintergenicDe novo--Yuen2017 G
GBE1     13515.p1chr3:
82236828-82236828
ATintergenicDe novo--Turner2016 G
GBE1     11194.p1chr3:
82322544-82322544
CTintergenicDe novo--Turner2016 G
GBE1     AU4452302chr3:
82675793-82675793
GAintergenicDe novo--Yuen2017 G
GBE1     AU4473301chr3:
82910859-82910859
GCintergenicDe novo--Yuen2017 G
GBE1     2-1220-003chr3:
83778200-83778200
CTintergenicDe novo--Yuen2016 G
Yuen2017 G
GBE1     AU1687302chr3:
81785732-81785732
GAintronicDe novo--Yuen2017 G
GBE1     2-1250-003chr3:
83326649-83326649
TCintergenicDe novo--Yuen2017 G
GBE1     AU3760302chr3:
81879594-81879594
AGintergenicDe novo--Yuen2017 G
GBE1     5-0073-003chr3:
83254461-83254461
TCintergenicDe novo--Yuen2017 G
GBE1     7-0254-003chr3:
83312604-83312604
GAintergenicDe novo--Yuen2017 G
GBE1     AU-24601chr3:
81691938-81691938
TCexonicnonsynonymous SNVNM_000158c.A986Gp.Y329C20.45.0E-4Doan2019 E
GBE1     7-0253-003chr3:
83546044-83546044
CTintergenicDe novo--Yuen2017 G
GBE1     AU3263301chr3:
82696845-82696845
AGintergenicDe novo--Yuen2017 G
GBE1     AU065304chr3:
81576149-81576149
CTintronicDe novo--Yuen2017 G
GBE1     1-0534-006chr3:
83542134-83542134
GAintergenicDe novo--Yuen2017 G
GBE1     60-2027chr3:
82018417-82018417
TCintergenicDe novo--Michaelson2012 G
GBE1     1-0547-003chr3:
83012634-83012634
GAintergenicDe novo--Yuen2017 G
GBE1     2-1436-003chr3:
83230313-83230320
ACGCGTTTAintergenicDe novo--Yuen2017 G
GBE1     2-1475-003chr3:
81545362-81545362
GAintronicDe novo--Yuen2017 G
GBE1     7-0082-003chr3:
82933635-82933635
AACCTTCTTCTACintergenicDe novo--Yuen2017 G
GBE1     AU3517301chr3:
81810096-81810096
GAintronicDe novo--Yuen2017 G
GBE1     2-0145-003chr3:
82436268-82436268
AGintergenicDe novo--Yuen2017 G
GBE1     7-0082-003chr3:
82732885-82732885
TTAAGintergenicDe novo--Yuen2017 G
GBE1     7-0219-003chr3:
82959592-82959592
GAintergenicDe novo--Yuen2017 G
GBE1     1-0226-005chr3:
83690824-83690824
CTintergenicDe novo--Yuen2017 G
GBE1     1-0226-005chr3:
82354870-82354870
TCintergenicDe novo--Yuen2017 G
GBE1     AU4234303chr3:
81683795-81683797
CAGCintronicDe novo--Yuen2017 G
GBE1     2-1617-003chr3:
82132253-82132253
TAintergenicDe novo--Yuen2017 G
GBE1     AU2129303chr3:
83275491-83275491
AGintergenicDe novo--Yuen2017 G
GBE1     2-1235-004chr3:
83033941-83033941
TCintergenicDe novo--Yuen2017 G
GBE1     5-0077-004chr3:
82397258-82397258
TCintergenicDe novo--Yuen2017 G
GBE1     2-1196-003chr3:
83432235-83432235
CTintergenicDe novo--Yuen2017 G
GBE1     AU0636303chr3:
83736287-83736287
GAintergenicDe novo--Yuen2017 G
GBE1     1-0972-003chr3:
81599745-81599745
AGintronicDe novo--Yuen2017 G
GBE1     3-0065-000chr3:
83686329-83686329
AGintergenicDe novo--Yuen2017 G
GBE1     1-0458-005chr3:
82168608-82168608
GAintergenicDe novo--Yuen2017 G
GBE1     AU021204chr3:
82658589-82658589
TCintergenicDe novo--Yuen2017 G
GBE1     AU3725302chr3:
83082109-83082109
GAintergenicDe novo--Yuen2017 G
GBE1     2-1114-003chr3:
83441899-83441899
GCintergenicDe novo--Yuen2017 G
GBE1     2-1486-003chr3:
83383902-83383902
TAintergenicDe novo--Yuen2017 G
GBE1     1-0972-003chr3:
83562001-83562001
GAintergenicDe novo--Yuen2017 G
GBE1     AU4197302chr3:
82048796-82048796
GAintergenicDe novo--Yuen2017 G
GBE1     AU073003chr3:
83575546-83575546
CTintergenicDe novo--Yuen2017 G
GBE1     1-0359-003chr3:
82276429-82276429
GCintergenicDe novo--Yuen2017 G
GBE1     2-1178-003chr3:
81557445-81557445
TCintronicDe novo--Yuen2017 G
GBE1     AU3725302chr3:
82931165-82931180
TAAACAAACAAACAAATAAACAAACAAAintergenicDe novo--Yuen2017 G
GBE1     5-0018-003chr3:
82948636-82948636
AGintergenicDe novo--Yuen2017 G
GBE1     AU4235303chr3:
82723966-82723966
GAintergenicDe novo--Yuen2017 G
GBE1     3-0080-000chr3:
82909812-82909812
TGintergenicDe novo--Yuen2016 G
GBE1     AU1687303chr3:
81785732-81785732
GAintronicDe novo--Yuen2017 G
GBE1     AU3764302chr3:
83797867-83797867
CTintergenicDe novo--Yuen2017 G
GBE1     AU1988302chr3:
82900202-82900204
CATCintergenicDe novo--Yuen2017 G
GBE1     AU047904chr3:
83330923-83330923
CTintergenicDe novo--Yuen2017 G
GBE1     iHART1821chr3:
81586077-81586077
CTexonicPaternalstopgainNM_000158c.G1788Ap.W596X37.0-Ruzzo2019 G
GBE1     iHART1824chr3:
81586077-81586077
CTexonicPaternalstopgainNM_000158c.G1788Ap.W596X37.0-Ruzzo2019 G
GBE1     2-1138-003chr3:
82506348-82506348
TCintergenicDe novo--Yuen2017 G
GBE1     iHART1896chr3:
81699022-81699022
CTexonicPaternalstopgainNM_000158c.G480Ap.W160X38.08.355E-6Ruzzo2019 G
GBE1     iHART3242chr3:
81627124-81627124
GAexonicPaternalstopgainNM_000158c.C1570Tp.R524X41.01.685E-5Ruzzo2019 G
GBE1     1-0559-004chr3:
83896721-83896721
TGintergenicDe novo--Yuen2017 G
GBE1     2-0264-004chr3:
83225540-83225540
GAintergenicDe novo--Yuen2017 G
GBE1     AU3849303chr3:
81978741-81978741
CTintergenicDe novo--Yuen2017 G
GBE1     AU047904chr3:
83597224-83597224
TCintergenicDe novo--Yuen2017 G
GBE1     1-0373-003chr3:
82911243-82911243
GAintergenicDe novo--Yuen2017 G
GBE1     12335.p1chr3:
83197187-83197189
GTCATTintergenicMaternal--Wilfert2021 G
GBE1     1-0572-003chr3:
83490975-83490977
CATCintergenicDe novo--Yuen2017 G
GBE1     AU3839302chr3:
82842895-82842895
CTintergenicDe novo--Yuen2017 G
GBE1     2-1719-003chr3:
83196498-83196498
TAintergenicDe novo--Yuen2017 G
GBE1     2-1272-003chr3:
83761393-83761393
GCintergenicDe novo--Yuen2016 G
GBE1     AU1668302chr3:
82247913-82247913
GCintergenicDe novo--Yuen2017 G
GBE1     2-1362-004chr3:
82078988-82078988
ATintergenicDe novo--Yuen2017 G
GBE1     AU059903chr3:
82462191-82462210
GTCTCTCTCTCTCTCTCTCTGTCTCTCTCTCTCTCTCTintergenicDe novo--Yuen2017 G
GBE1     AU073005chr3:
82058005-82058005
AGintergenicDe novo--Yuen2017 G
GBE1     AU073005chr3:
83575546-83575546
CTintergenicDe novo--Yuen2017 G
GBE1     1-0112-004chr3:
82847929-82847929
AGintergenicDe novo--Yuen2017 G
GBE1     AU009903chr3:
81995918-81995918
GAintergenicDe novo--Yuen2017 G
GBE1     AU3692302chr3:
83890190-83890190
GAintergenicDe novo--Yuen2017 G
GBE1     1-0067-004chr3:
82628322-82628322
CCTACTTintergenicDe novo--Yuen2017 G
GBE1     1-0024-003chr3:
81575607-81575607
GAintronicDe novo--Yuen2017 G
GBE1     2-1440-003chr3:
83755689-83755689
GAintergenicDe novo--Yuen2016 G
Yuen2017 G
GBE1     1-0032-003chr3:
82779014-82779014
ATintergenicDe novo--Yuen2017 G
GBE1     1-0912-003chr3:
82010460-82010460
AGintergenicDe novo--Yuen2017 G
GBE1     AU4067301chr3:
82814823-82814823
AGintergenicDe novo--Yuen2017 G
GBE1     2-1230-003chr3:
81993694-81993694
GTintergenicDe novo--Yuen2017 G
GBE1     1-0197-004chr3:
81723173-81723173
AGintronicDe novo--Yuen2017 G
GBE1     1-0295-003chr3:
83194140-83194140
AGintergenicDe novo--Yuen2017 G
GBE1     1-0051-005chr3:
81555426-81555426
GGATintronicDe novo--Yuen2017 G
GBE1     AU3852301chr3:
83176428-83176428
TCintergenicDe novo--Yuen2017 G
GBE1     1-0455-003chr3:
81999499-81999499
CTintergenicDe novo--Yuen2017 G
GBE1     AU3861301chr3:
82176634-82176634
GCintergenicDe novo--Yuen2017 G
GBE1     AU2072302chr3:
83457292-83457292
AGintergenicDe novo--Yuen2017 G
GBE1     AU3729301chr3:
83130587-83130587
AGintergenicDe novo--Yuen2017 G
GBE1     AU2793302chr3:
81770918-81770918
TCintronicDe novo--Yuen2017 G
GBE1     2-1295-003chr3:
81982069-81982070
CTCintergenicDe novo--Yuen2017 G
GBE1     5-0109-003chr3:
82010917-82010917
AGintergenicDe novo--Yuen2017 G
GBE1     2-1195-003chr3:
83698773-83698773
CTintergenicDe novo--Yuen2016 G
Yuen2017 G
GBE1     7-0255-003chr3:
82045750-82045750
TCintergenicDe novo--Yuen2017 G
GBE1     2-1511-003chr3:
82261507-82261507
ATintergenicDe novo--Yuen2017 G
GBE1     2-0149-003chr3:
82970563-82970563
CTintergenicDe novo--Yuen2017 G
GBE1     AU3937301chr3:
82077759-82077759
AGintergenicDe novo--Yuen2017 G
GBE1     AU3937301chr3:
83204056-83204059
AAGAAAintergenicDe novo--Yuen2017 G
GBE1     AU4423303chr3:
82101197-82101197
AGintergenicDe novo--Yuen2017 G
GBE1     1-0971-003chr3:
81827467-81827467
CAintergenicDe novo--Yuen2017 G
GBE1     2-0197-004chr3:
82677645-82677645
AGintergenicDe novo--Yuen2017 G
GBE1     1-0579-003chr3:
82893579-82893579
GAintergenicDe novo--Yuen2017 G
GBE1     1-0925-003chr3:
83304702-83304702
GAintergenicDe novo--Yuen2017 G
GBE1     1-0965-003chr3:
81846613-81846613
GAintergenicDe novo--Yuen2017 G
GBE1     1-0533-003chr3:
83317848-83317850
TCATintergenicDe novo--Yuen2017 G
GBE1     DEASD_0277_001chr3:
81539663-81539663
CTintronicDe novo--Kosmicki2017 E
Satterstrom2020 E
GBE1     1-0300-004chr3:
83690564-83690564
GAintergenicDe novo--Yuen2017 G
GBE1     2-0033-003chr3:
82014614-82014614
TAintergenicDe novo--Yuen2016 G
Yuen2017 G
GBE1     AU072004chr3:
82564942-82564942
GAintergenicDe novo--Yuen2017 G
GBE1     2-0033-003chr3:
82014605-82014605
ATintergenicDe novo--Yuen2016 G
Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More