or
or
Exact

Results for "RAB2A"

Variant Events: 17

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
RAB2A     13537.p1chr8:
61484615-61484615
CTexonicDe novosynonymous SNVNM_001242644
NM_002865
c.C57T
c.C129T
p.F19F
p.F43F
-9.578E-5Iossifov2012 E
Iossifov2014 E
Kosmicki2017 E
Satterstrom2020 E
RAB2A     AU4347301chr8:
61463523-61463531
TTTCTTCTTTTTCTTintronicDe novo--Yuen2017 G
RAB2A     1-1004-003chr8:
61493920-61493920
GAintronicDe novo--Yuen2017 G
RAB2A     3-0458-000Bchr8:
61440999-61440999
TCintronicDe novo--Yuen2017 G
RAB2A     1-0497-003chr8:
61583767-61583781
TAGAGAGAGAGAGAGTAGAGAGAGAGAGintergenicDe novo--Yuen2017 G
RAB2A     11077.p1chr8:
61484622-61484622
CTexonicDe novostopgainNM_001242644
NM_002865
c.C64T
c.C136T
p.R22X
p.R46X
28.2-Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Krupp2017 E
Sanders2012 E
Satterstrom2020 E
Wilfert2021 G
Willsey2013 E
RAB2A     Uddin2014:25chr8:
61484622-61484622
CTexonicDe novostopgainNM_001242644
NM_002865
c.C64T
c.C136T
p.R22X
p.R46X
28.2-Uddin2014 E
RAB2A     M18426chr8:
61504467-61504467
CTexonicUnknownnonsynonymous SNVNM_001242644
NM_002865
c.C341T
c.C413T
p.A114V
p.A138V
36.0-Guo2018 T
Wang2016 T
RAB2A     NDAR_INVRT684RNC_wes1chr8:
61533310-61533310
TGexonicDe novosynonymous SNVNM_001242644
NM_002865
c.T549G
c.T621G
p.A183A
p.A207A
12.25-Lim2017 E
RAB2A     AU4487302chr8:
61442234-61442234
AGintronicDe novo--Yuen2017 G
RAB2A     3-0458-000Achr8:
61440999-61440999
TCintronicDe novo--Yuen2017 G
RAB2A     SSC02583chr8:
61484622-61484622
CTexonicDe novostopgainNM_001242644
NM_002865
c.C64T
c.C136T
p.R22X
p.R46X
28.2-Lim2017 E
RAB2A     1-0381-003chr8:
61531711-61531715
TAAAATAAintronicDe novo--Yuen2017 G
RAB2A     2-1255-003chr8:
61431261-61431276
CGTGTGTGTGTGTGTGCGTGTGTGTGTGTGintronicDe novo--Yuen2017 G
RAB2A     3-0458-000chr8:
61440999-61440999
TCintronicDe novo--Yuen2016 G
RAB2A     7-0128-003chr8:
61539055-61539055
TAintergenicDe novo--Yuen2017 G
RAB2A     AU3727302chr8:
61506025-61506025
GAintronicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More