or
or
Exact

Results for "CACNA2D3"

Variant Events: 116

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
CACNA2D3     2-0007-003chr3:
54290015-54290015
GGAintronicDe novo--Yuen2017 G
CACNA2D3     1-0914-003chr3:
55003272-55003272
TCintronicDe novo--Yuen2017 G
CACNA2D3     220-9950-201chr3:
54925422-54925422
CGexonicUnknownnonsynonymous SNVNM_018398c.C2191Gp.R731G19.64-Stessman2017 T
Wang2020 T
Wang2020 T
CACNA2D3     1-0495-003chr3:
54823070-54823070
GAintronicDe novo--Yuen2017 G
CACNA2D3     AU3076302chr3:
54440361-54440361
GAintronicDe novo--Yuen2017 G
CACNA2D3     149194chr3:
54922022-54922022
CTexonicUnknownnonsynonymous SNVNM_018398c.C2093Tp.A698V35.09.109E-5Wang2020 T
Wang2020 T
Wang2020 T
CACNA2D3     AU3782302chr3:
54305322-54305322
ATintronicDe novo--Yuen2017 G
CACNA2D3     2-1645-003chr3:
55177677-55177677
CAintergenicDe novo--Yuen2017 G
CACNA2D3     AU1988301chr3:
54842645-54842645
CTintronicDe novo--Yuen2017 G
CACNA2D3     63465272chr3:
54933874-54933874
CTexonicUnknownnonsynonymous SNVNM_018398c.C2428Tp.R810W23.29.301E-5Wang2020 T
CACNA2D3     1-0323-003chr3:
54804356-54804359
AGTTAintronicDe novo--Yuen2017 G
CACNA2D3     65686222chr3:
54933874-54933874
CTexonicUnknownnonsynonymous SNVNM_018398c.C2428Tp.R810W23.29.301E-5Wang2020 T
CACNA2D3     69465979chr3:
54933874-54933874
CTexonicUnknownnonsynonymous SNVNM_018398c.C2428Tp.R810W23.29.301E-5Wang2020 T
CACNA2D3     AU2089302chr3:
54229576-54229576
ACintronicDe novo--Yuen2017 G
CACNA2D3     AU039305chr3:
55305842-55305842
AGintergenicDe novo--Yuen2017 G
CACNA2D3     PN400369chr3:
54925426-54925426
CTexonicUnknownnonsynonymous SNVNM_018398c.C2195Tp.T732M25.80.0076Leblond2019 E
CACNA2D3     1-0382-003chr3:
55317343-55317343
TAintergenicDe novo--Yuen2017 G
CACNA2D3     AU066203; Leidenchr3:
54919550-54919550
CTexonicUnknownnonsynonymous SNVNM_018398c.C1993Tp.R665C31.05.194E-5Wang2020 T
CACNA2D3     1-0530-003chr3:
54869192-54869192
GTintronicDe novo--Yuen2016 G
Yuen2017 G
CACNA2D3     M23096; ACGCchr3:
54930847-54930847
CTexonicUnknownnonsynonymous SNVNM_018398c.C2318Tp.A773V34.0-Wang2020 T
CACNA2D3     345488chr3:
54930880-54930880
CTexonicUnknownnonsynonymous SNVNM_018398c.C2351Tp.S784L26.68.281E-6Wang2020 T
Wang2020 T
CACNA2D3     11625.p1chr3:
54867617-54867617
GGAintronicDe novo--Werling2018 G
CACNA2D3     BK_725_03chr3:
54604055-54604055
GAexonicUnknownnonsynonymous SNVNM_018398c.G812Ap.R271H28.28.302E-6Wang2020 T
Wang2020 T
CACNA2D3     AU0863301chr3:
54925398-54925398
GAexonicUnknownnonsynonymous SNVNM_018398c.G2167Ap.V723M23.71.658E-5Stessman2017 T
Wang2020 T
Wang2020 T
CACNA2D3     AU3632301chr3:
54166814-54166814
CGintronicDe novo--Yuen2017 G
CACNA2D3     3-0432-000chr3:
55058628-55058628
GTintronicDe novo--Yuen2017 G
CACNA2D3     SD0023.p1chr3:
54850898-54850898
GAsplicingMaternalsplicing21.9-Guo2018 T
Wang2020 T
Wang2020 T
CACNA2D3     1-0384-003chr3:
54824021-54824021
CTintronicDe novo--Yuen2017 G
CACNA2D3     1-0715-003chr3:
55212484-55212484
GCintergenicDe novo--Yuen2017 G
CACNA2D3     AU0636303chr3:
54766563-54766563
CTintronicDe novo--Yuen2017 G
CACNA2D3     3-0439-000chr3:
55013341-55013341
TGintronicDe novo--Yuen2016 G
CACNA2D3     AU1271303chr3:
54676264-54676264
GAexonicMaternalnonsynonymous SNVNM_018398c.G1163Ap.R388Q34.01.09E-5Stessman2017 T
Wang2020 T
Wang2020 T
CACNA2D3     2-1646-003chr3:
54171108-54171108
CTintronicDe novo--Yuen2017 G
CACNA2D3     PN400576chr3:
54925426-54925426
CTexonicUnknownnonsynonymous SNVNM_018398c.C2195Tp.T732M25.80.0076Leblond2019 E
CACNA2D3     AU4159301chr3:
55068689-55068689
TCintronicDe novo--Yuen2017 G
CACNA2D3     M16226chr3:
54930847-54930847
CTexonicPaternal, Unknownnonsynonymous SNVNM_018398c.C2318Tp.A773V34.0-Guo2018 T
Wang2020 T
Wang2020 T
CACNA2D3     PN400480chr3:
54925426-54925426
CTexonicUnknownnonsynonymous SNVNM_018398c.C2195Tp.T732M25.80.0076Leblond2019 E
CACNA2D3     11440.p1chr3:
54400607-54400607
TGintronicDe novo--Wilfert2021 G
CACNA2D3     14652.p1chr3:
55027447-55027447
GAintronicDe novo--Wilfert2021 G
CACNA2D3     M30832chr3:
55038848-55038848
GAexonicMaternalnonsynonymous SNVNM_018398c.G2749Ap.A917T32.08.286E-6Guo2018 T
CACNA2D3     1-0882-003chr3:
54887104-54887104
ACintronicDe novo--Yuen2017 G
CACNA2D3     2-1561-003chr3:
54804929-54804929
CGintronicDe novo--Yuen2017 G
CACNA2D3     AU4033305chr3:
55337630-55337630
CTintergenicDe novo--Yuen2017 G
CACNA2D3     PN400209chr3:
54925426-54925426
CTexonicUnknownnonsynonymous SNVNM_018398c.C2195Tp.T732M25.80.0076Leblond2019 E
CACNA2D3     2-1561-003chr3:
54493097-54493097
AGintronicDe novo--Yuen2017 G
CACNA2D3     1-0323-004chr3:
54804356-54804359
AGTTAintronicDe novo--Yuen2017 G
CACNA2D3     1-0079-003chr3:
55057372-55057372
CGintronicDe novo--Yuen2017 G
CACNA2D3     AU3730301chr3:
54558507-54558507
GAintronicDe novo--Yuen2017 G
CACNA2D3     AU3779302chr3:
55329623-55329623
CAintergenicDe novo--Yuen2017 G
CACNA2D3     2-1389-003chr3:
55220405-55220405
TAintergenicDe novo--Yuen2016 G
Yuen2017 G
CACNA2D3     AU1952305chr3:
54750058-54750058
AGintronicDe novo--Yuen2017 G
CACNA2D3     PN400125chr3:
54925426-54925426
CTexonicUnknownnonsynonymous SNVNM_018398c.C2195Tp.T732M25.80.0076Leblond2019 E
CACNA2D3     PN400505chr3:
54925426-54925426
CTexonicUnknownnonsynonymous SNVNM_018398c.C2195Tp.T732M25.80.0076Leblond2019 E
CACNA2D3     1-0936-003chr3:
54188769-54188769
GAintronicDe novo--Yuen2017 G
CACNA2D3     M12496chr3:
54798256-54798257
CACexonicUnknownframeshift deletionNM_018398c.1259delAp.Q420fs--Wang2020 T
Wang2020 T
CACNA2D3     238848chr3:
55107828-55107828
GAexonicUnknownnonsynonymous SNVNM_018398c.G3125Ap.R1042H32.0-Wang2020 T
Wang2020 T
CACNA2D3     13526.p1chr3:
54921984-54921984
AGsplicingDe novosplicing17.81-Iossifov2012 E
Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Krupp2017 E
Satterstrom2020 E
Wang2020 T
Wilfert2021 G
Willsey2013 E
CACNA2D3     AU4235301chr3:
55397617-55397617
AGintergenicDe novo--Yuen2017 G
CACNA2D3     D1.11.00230chr3:
54919550-54919550
CTexonicUnknownnonsynonymous SNVNM_018398c.C1993Tp.R665C31.05.194E-5Wang2020 T
Wang2020 T
CACNA2D3     M8461chr3:
54930847-54930847
CTexonicUnknownnonsynonymous SNVNM_018398c.C2318Tp.A773V34.0-Wang2020 T
Wang2020 T
Wang2020 T
CACNA2D3     U7D8Zchr3:
55052345-55052345
GCsplicingUnknownsplicing21.9-Wang2020 T
Wang2020 T
Wang2020 T
CACNA2D3     AU066203chr3:
54919550-54919550
CTexonicUnknownnonsynonymous SNVNM_018398c.C1993Tp.R665C31.05.194E-5Wang2020 T
Wang2020 T
CACNA2D3     2-1116-003chr3:
55172141-55172141
ACintergenicDe novo--Yuen2017 G
CACNA2D3     M8584chr3:
54604055-54604055
GTexonicUnknownnonsynonymous SNVNM_018398c.G812Tp.R271L21.4-Wang2020 T
Wang2020 T
CACNA2D3     2-1116-003chr3:
55172139-55172139
ACintergenicDe novo--Yuen2017 G
CACNA2D3     M8755chr3:
54537564-54537564
GAexonicUnknownnonsynonymous SNVNM_018398c.G427Ap.G143R25.7-Wang2020 T
Wang2020 T
CACNA2D3     2-0149-005chr3:
55088008-55088012
TTCTGTintronicDe novo--Yuen2017 G
CACNA2D3     HN0106.p1chr3:
54596895-54596895
CTexonicUnknownnonsynonymous SNVNM_018398c.C613Tp.R205C23.08.356E-6Wang2020 T
Wang2020 T
CACNA2D3     2-1378-003chr3:
54796134-54796134
TCintronicDe novo--Yuen2017 G
CACNA2D3     211-5650-3chr3:
54596895-54596895
CTexonicUnknownnonsynonymous SNVNM_018398c.C613Tp.R205C23.08.356E-6Wang2020 T
Wang2020 T
Wang2020 T
CACNA2D3     N2A2Jchr3:
55052345-55052345
GCsplicingUnknownsplicing21.9-Wang2020 T
Wang2020 T
CACNA2D3     AU066204chr3:
54919550-54919550
CTexonicUnknownnonsynonymous SNVNM_018398c.C1993Tp.R665C31.05.194E-5Wang2020 T
Wang2020 T
CACNA2D3     1-0514-003chr3:
54649442-54649442
CTintronicDe novo--Yuen2016 G
Yuen2017 G
CACNA2D3     M23110chr3:
54604066-54604066
GAexonicPaternalnonsynonymous SNVNM_018398c.G823Ap.A275T32.0-Guo2018 T
Wang2016 T
Wang2020 T
Wang2020 T
CACNA2D3     1-0868-003chr3:
55229319-55229319
AGintergenicDe novo--Yuen2017 G
CACNA2D3     PN400128chr3:
54925426-54925426
CTexonicUnknownnonsynonymous SNVNM_018398c.C2195Tp.T732M25.80.0076Leblond2019 E
CACNA2D3     2-0270-003chr3:
54535611-54535611
TCintronicDe novo--Yuen2017 G
CACNA2D3     PN400157chr3:
54925426-54925426
CTexonicUnknownnonsynonymous SNVNM_018398c.C2195Tp.T732M25.80.0076Leblond2019 E
CACNA2D3     A28chr3:
54386936-54386936
GAintronicDe novo--Wu2018 G
CACNA2D3     AU3635301chr3:
55259731-55259731
TGintergenicDe novo--Yuen2017 G
CACNA2D3     2-1254-003chr3:
54244479-54244479
GAintronicDe novo--Yuen2016 G
CACNA2D3     M08461chr3:
54930847-54930847
CTexonicMaternalnonsynonymous SNVNM_018398c.C2318Tp.A773V34.0-Guo2018 T
Wang2016 T
CACNA2D3     M23096chr3:
54930847-54930847
CTexonicMaternal, Unknownnonsynonymous SNVNM_018398c.C2318Tp.A773V34.0-Guo2018 T
Wang2016 T
Wang2020 T
Wang2020 T
CACNA2D3     217-14277-4000chr3:
54925395-54925395
GAexonicPaternalnonsynonymous SNVNM_018398c.G2164Ap.G722S33.0-Stessman2017 T
Wang2020 T
Wang2020 T
CACNA2D3     5-0077-003chr3:
55368141-55368141
GAintergenicDe novo--Yuen2017 G
CACNA2D3     SX0037.p1chr3:
54922022-54922022
CTexonicMaternalnonsynonymous SNVNM_018398c.C2093Tp.A698V35.09.109E-5Guo2018 T
Wang2020 T
Wang2020 T
CACNA2D3     PN400102chr3:
54925426-54925426
CTexonicUnknownnonsynonymous SNVNM_018398c.C2195Tp.T732M25.80.0076Leblond2019 E
CACNA2D3     AU061104chr3:
54658529-54658529
GAintronicDe novo--Yuen2017 G
CACNA2D3     2-1350-003chr3:
54344863-54344865
CAACintronicDe novo--Yuen2017 G
CACNA2D3     AU2950302chr3:
54839030-54839030
TCintronicDe novo--Yuen2017 G
CACNA2D3     2-1619-004chr3:
55093044-55093044
TTTTTGTTCATGTCATGCAAAATGAACAAAATCCintronicDe novo--Yuen2017 G
CACNA2D3     1-1004-003chr3:
54953558-54953558
GAintronicDe novo--Yuen2017 G
CACNA2D3     SSC08101chr3:
54921984-54921984
AGsplicingDe novosplicing17.81-Lim2017 E
CACNA2D3     AU3847302chr3:
54234421-54234421
CTintronicDe novo--Yuen2017 G
CACNA2D3     AU4211304chr3:
55076849-55076849
GAintronicDe novo--Yuen2017 G
CACNA2D3     11456.p1chr3:
54743403-54743403
CTintronicDe novo--Turner2016 G
CACNA2D3     1-0998-003chr3:
54544240-54544263
AATGGATGGATGGATGGATGGATGAATGGATGGATGGATGGATGintronicDe novo--Yuen2017 G
CACNA2D3     14015.p1chr3:
54817006-54817006
GCintronicDe novo--Turner2016 G
CACNA2D3     14153.p1chr3:
54158012-54158012
TCintronicDe novo--Turner2016 G
CACNA2D3     UK10K_SKUSE5080203chr3:
54872646-54872646
GTexonicDe novostopgainNM_018398c.G1522Tp.E508X38.0-DeRubeis2014 E
Kosmicki2017 E
Satterstrom2020 E
Wang2020 T
CACNA2D3     14153.p1chr3:
54218542-54218542
ATintronicDe novo--Turner2016 G
CACNA2D3     AU3997302chr3:
54243814-54243814
GAintronicDe novo--Yuen2017 G
CACNA2D3     13539.p1chr3:
55442761-55442761
TCintergenicDe novo--Turner2016 G
CACNA2D3     1-0286-004chr3:
54553063-54553063
GAintronicDe novo--Yuen2017 G
CACNA2D3     AU4234302chr3:
55038368-55038368
AGintronicDe novo--Yuen2017 G
CACNA2D3     10-10576chr3:
54925426-54925426
CGexonicDe novononsynonymous SNVNM_018398c.C2195Gp.T732R28.98.293E-6Wang2020 T
Wang2020 T
CACNA2D3     Uddin2014:22chr3:
54921984-54921984
AGsplicingDe novosplicing17.81-Uddin2014 E
CACNA2D3     AU4234302chr3:
55038555-55038555
CTintronicDe novo--Yuen2017 G
CACNA2D3     13539.p1chr3:
55092920-55092920
TCintronicDe novo--Turner2016 G
CACNA2D3     AU4234302chr3:
55038557-55038557
CTintronicDe novo--Yuen2017 G
CACNA2D3     12568.p1chr3:
55143727-55143727
TCintergenicDe novo--Turner2016 G
CACNA2D3     AU3638302chr3:
54175989-54175989
GAintronicDe novo--Yuen2017 G
CACNA2D3     7-0249-004chr3:
54469795-54469795
TCintronicDe novo--Yuen2017 G
CACNA2D3     2-1089-004chr3:
55420129-55420129
ATintergenicDe novo--Yuen2017 G
CACNA2D3     1-0049-004chr3:
54423818-54423818
CGintronicDe novo--Yuen2017 G
CACNA2D3     2-0129-004chr3:
55348403-55348403
GAintergenicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More