or
or
Exact

Results for "CFAP46"

Variant Events: 37

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
CFAP46     11480.p1chr10:
134745272-134745272
CCCCACATintronicDe novo--Krumm2015 E
CFAP46     AU2140305chr10:
134677025-134677031
CCAATGCCCintronicDe novo--Yuen2017 G
CFAP46     iHART3297chr10:
134681013-134681013
TGsplicingMaternalsplicing8.918-Ruzzo2019 G
CFAP46     AU026604chr10:
134689069-134689069
GAintronicDe novo--Yuen2017 G
CFAP46     iHART2962chr10:
134673921-134673922
CTCexonicMaternalframeshift deletionNM_001200049c.5197delAp.R1733fs--Ruzzo2019 G
CFAP46     iHART2630chr10:
134713076-134713076
GAexonicPaternalstopgainNM_001200049c.C3019Tp.R1007X38.05.0E-4Ruzzo2019 G
CFAP46     iHART3295chr10:
134681013-134681013
TGsplicingMaternalsplicing8.918-Ruzzo2019 G
CFAP46     1-0394-003chr10:
134636528-134636543
TGCTGTGTGTGCGCTGTGCTGintronicDe novo--Yuen2017 G
CFAP46     2-0018-004chr10:
134701885-134701886
CTCintronicDe novo--Yuen2017 G
CFAP46     AU076704chr10:
134736085-134736085
GAexonicDe novononsynonymous SNVNM_001200049c.C1384Tp.R462W11.0-Yuen2017 G
CFAP46     AU074503chr10:
134609638-134609638
TGintergenicDe novo--Yuen2017 G
CFAP46     AU074503chr10:
134609650-134609650
TCintergenicDe novo--Yuen2017 G
CFAP46     4304_16mrchr10:
134663940-134663940
CTintronicDe novo-9.546E-5Fu2022 E
CFAP46     1-0518-003chr10:
134696773-134696773
CTintronicDe novo--Yuen2016 G
Yuen2017 G
CFAP46     1002717394-Cchr10:
134647515-134647515
AGintronicDe novo--Fu2022 E
CFAP46     11482.p1chr10:
134752145-134752145
CTexonicDe novo, Mosaicnonsynonymous SNVNM_001200049c.G484Ap.V162M12.592.484E-5Ji2016 E
Krumm2015 E
Krupp2017 E
CFAP46     1-0863-003chr10:
134696937-134696937
ATintronicDe novo--Yuen2017 G
CFAP46     12579.p1chr10:
134743800-134743800
AGintronicDe novo--Iossifov2012 E
Iossifov2014 E
Kosmicki2017 E
CFAP46     1-0507-003chr10:
134692229-134692229
GTintronicDe novo--Yuen2016 G
Yuen2017 G
CFAP46     1-0507-003chr10:
134638199-134638199
TCintronicDe novo--Yuen2017 G
CFAP46     AU3765303chr10:
134635617-134635625
CTGTGTGTGCTGTGTGintronicDe novo--Yuen2017 G
CFAP46     DEASD_1079_001chr10:
134626272-134626272
GAintronicDe novo--Satterstrom2020 E
CFAP46     ASC_NP275chr10:
134690316-134690316
CAexonicDe novosynonymous SNVNM_001200049c.G4362Tp.P1454P--Fu2022 E
CFAP46     1-0554-003chr10:
134706460-134706460
GCintronicDe novo--Yuen2017 G
CFAP46     AU3765302chr10:
134635617-134635625
CTGTGTGTGCTGTGTGintronicDe novo--Yuen2017 G
CFAP46     05C43787chr10:
134740039-134740039
TCintronicDe novo--Satterstrom2020 E
CFAP46     SP0042113chr10:
134699420-134699420
CGexonicDe novosynonymous SNVNM_001200049c.G3348Cp.L1116L--Fu2022 E
CFAP46     SP0126624chr10:
134626295-134626295
AGexonicDe novosynonymous SNVNM_001200049c.T7495Cp.L2499L--Fu2022 E
CFAP46     SP0114923chr10:
134671059-134671059
AGintronicDe novo--Fu2022 E
CFAP46     SP0096757chr10:
134659549-134659549
GAintronicDe novo-2.365E-5Fu2022 E
CFAP46     SP0111893chr10:
134674441-134674441
CTexonicDe novononsynonymous SNVNM_001200049c.G4936Ap.A1646T12.08-Fu2022 E
CFAP46     SP0082491chr10:
134682866-134682866
CTexonicDe novononsynonymous SNVNM_001200049c.G4522Ap.A1508T10.827.407E-5Fu2022 E
CFAP46     SP0088294chr10:
134628410-134628410
CTexonicDe novononsynonymous SNVNM_001200049c.G7126Ap.V2376M4.5258.24E-6Fu2022 E
CFAP46     SP0012384chr10:
134722217-134722217
GAintronicDe novo--Fu2022 E
CFAP46     SP0071311chr10:
134691646-134691646
CGintronicDe novo--Fu2022 E
CFAP46     1-0400-003chr10:
134635877-134635877
CAintronicDe novo--Yuen2017 G
CFAP46     SP0130244chr10:
134726815-134726815
CTintronicDe novo--Fu2022 E
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More