or
or
Exact

Results for "NCK2"

Variant Events: 20

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
NCK2     AU3702307chr2:
106437585-106437585
ACintronicDe novo--Yuen2017 G
NCK2     1-0274-003chr2:
106675892-106675892
CTintergenicDe novo--Yuen2017 G
NCK2     2-0238-004chr2:
106576479-106576479
CTintergenicDe novo--Yuen2017 G
NCK2     2-1391-004chr2:
106446595-106446595
CTintronicDe novo--Yuen2017 G
NCK2     7-0188-003chr2:
106498491-106498491
GCexonicDe novononsynonymous SNVNM_001004720
NM_003581
c.G934C
c.G934C
p.D312H
p.D312H
26.62.02E-5Yuen2017 G
NCK2     2-1506-003chr2:
106493378-106493378
GAintronicDe novo--Yuen2017 G
NCK2     2-1689-003chr2:
106392664-106392664
CTintronicDe novo--Yuen2017 G
NCK2     AU2215302chr2:
106473219-106473219
ATintronicDe novo--Yuen2017 G
NCK2     iHART3026chr2:
106509613-106509613
TTCGTCAGGGCCCTGCAGTGAexonicPaternalstopgainNM_001004720
NM_003581
c.1124_1125insCGTCAGGGCCCTGCAGTGA
c.1124_1125insCGTCAGGGCCCTGCAGTGA
p.L375_V376delinsLVRALQX
p.L375_V376delinsLVRALQX
--Ruzzo2019 G
NCK2     2-1509-003chr2:
106586073-106586073
GAintergenicDe novo--Yuen2017 G
NCK2     A4chr2:
106396467-106396467
AGintronicDe novo--Wu2018 G
NCK2     AU2019302chr2:
106561510-106561510
CTintergenicDe novo--Yuen2017 G
NCK2     1-0274-004chr2:
106675892-106675892
CTintergenicDe novo--Yuen2017 G
NCK2     7-0100-004chr2:
106656685-106656685
ATintergenicDe novo--Yuen2017 G
NCK2     3-0312-000chr2:
106471675-106471675
GAexonicDe novosynonymous SNVNM_001004720
NM_001004722
NM_003581
c.G156A
c.G156A
c.G156A
p.P52P
p.P52P
p.P52P
-4.382E-5Tammimies2015 E
NCK2     AU4250301chr2:
106560879-106560879
GCintergenicDe novo--Yuen2017 G
NCK2     AU012804chr2:
106526424-106526424
GAintergenicDe novo--Yuen2017 G
NCK2     AU4211304chr2:
106422974-106422974
CTintronicDe novo--Yuen2017 G
NCK2     1-0336-004chr2:
106374093-106374093
CGintronicDe novo--Yuen2017 G
NCK2     AU3721302chr2:
106660371-106660371
CAintergenicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More