or
or
Exact

Results for "CEP192"

Variant Events: 15

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
CEP192     14174.p1chr18:
13049312-13049312
CAexonicDe novononsynonymous SNVNM_032142c.C2522Ap.T841K3.402-Iossifov2014 E
Kosmicki2017 E
Satterstrom2020 E
CEP192     1-0119-004chr18:
13092263-13092263
CTintronicDe novo--Yuen2017 G
CEP192     3-0410-000chr18:
13019104-13019104
AGexonicDe novononsynonymous SNVNM_032142c.A949Gp.S317G0.053-Tammimies2015 E
CEP192     7-0166-003chr18:
13192057-13192057
GCintergenicDe novo--Yuen2017 G
CEP192     AU4476302chr18:
13068562-13068564
TGGTGintronicDe novo--Yuen2017 G
CEP192     1-0233-004chr18:
13204963-13204963
TCintergenicDe novo--Yuen2017 G
CEP192     AU066403chr18:
13045644-13045644
AGintronicDe novo--Yuen2017 G
CEP192     G01-GEA-130-HIchr18:
13095502-13095502
CTexonicDe novosynonymous SNVNM_032142c.C6255Tp.S2085S-6.678E-5Satterstrom2020 E
CEP192     1-0998-003chr18:
13028596-13028596
GAintronicDe novo--Yuen2017 G
CEP192     2-1452-003chr18:
13167999-13167999
TCintergenicDe novo--Yuen2016 G
Yuen2017 G
CEP192     1-0208-003chr18:
13062380-13062380
GCintronicDe novo--Yuen2017 G
CEP192     iHART2944chr18:
13056554-13056554
GAexonicPaternalstopgainNM_032142c.G3965Ap.W1322X29.2-Ruzzo2019 G
CEP192     1-0508-003chr18:
13025034-13025034
GTintronicDe novo--Yuen2017 G
CEP192     1-0558-003chr18:
13203571-13203586
CAGAGAGAGAGAGAGACAGAGAGAGAGAGAintergenicDe novo--Yuen2017 G
CEP192     SSC10957chr18:
13049312-13049312
CAexonicDe novononsynonymous SNVNM_032142c.C2522Ap.T841K3.402-Lim2017 E
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More