or
or
Exact

Results for "MEGF11"

Variant Events: 39

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
MEGF11     AU3586303chr15:
66515751-66515751
GCintronicDe novo--Yuen2017 G
MEGF11     SP0077342chr15:
66274556-66274556
TAintronicDe novo--Fu2022 E
MEGF11     12056.p1chr15:
66198459-66198459
GAexonicDe novo, Mosaicnonsynonymous SNVNM_032445c.C2731Tp.R911C16.381.0E-4Dou2017 E
Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Krupp2017 E
Sanders2012 E
Satterstrom2020 E
MEGF11     SP0061192chr15:
66204396-66204396
GAintronicDe novo--Fu2022 E
MEGF11     11205.p1chr15:
66208524-66208524
GAexonicDe novononsynonymous SNVNM_032445c.C2306Tp.T769I20.7-Iossifov2014 E
Ji2016 E
Kosmicki2017 E
O’Roak2012b E
Satterstrom2020 E
Wilfert2021 G
MEGF11     1-0206-004chr15:
66387134-66387134
CGintronicDe novo--Yuen2017 G
MEGF11     SP0056461chr15:
66191332-66191332
ACintronicDe novo--Fu2022 E
MEGF11     SP0007019chr15:
66207896-66207896
TCexonicDe novosynonymous SNVNM_032445c.A2385Gp.L795L16.43-Fu2022 E
MEGF11     2-0013-003chr15:
66202232-66202232
CAintronicDe novo--Yuen2017 G
MEGF11     PN400117chr15:
66206090-66206090
CTexonicUnknownnonsynonymous SNVNM_032445c.G2695Ap.D899N25.50.001Leblond2019 E
MEGF11     2-1502-003chr15:
66450364-66450364
CTintronicDe novo--Yuen2017 G
MEGF11     PN400530chr15:
66206090-66206090
CTexonicUnknownnonsynonymous SNVNM_032445c.G2695Ap.D899N25.50.001Leblond2019 E
MEGF11     PN400261chr15:
66206090-66206090
CTexonicUnknownnonsynonymous SNVNM_032445c.G2695Ap.D899N25.50.001Leblond2019 E
MEGF11     5333chr15:
66208524-66208524
GAexonicDe novononsynonymous SNVNM_032445c.C2306Tp.T769I20.7-Fu2022 E
MEGF11     1-0551-003chr15:
66297091-66297091
AGintronicDe novo--Yuen2017 G
MEGF11     2-0182-003chr15:
66190148-66190148
GCUTR3De novo--Yuen2017 G
MEGF11     PN400100chr15:
66206090-66206090
CTexonicUnknownnonsynonymous SNVNM_032445c.G2695Ap.D899N25.50.001Leblond2019 E
MEGF11     2-1210-003chr15:
66345862-66345862
CTintronicDe novo--Yuen2017 G
MEGF11     PN400284chr15:
66206090-66206090
CTexonicUnknownnonsynonymous SNVNM_032445c.G2695Ap.D899N25.50.001Leblond2019 E
MEGF11     2-0018-004chr15:
66363292-66363292
TGintronicDe novo--Yuen2017 G
MEGF11     iHART3215chr15:
66250017-66250017
CTexonicPaternalstopgainNM_032445c.G1155Ap.W385X37.0-Ruzzo2019 G
MEGF11     1-0460-003chr15:
66412290-66412290
CAintronicDe novo--Yuen2017 G
MEGF11     PN400554chr15:
66206090-66206090
CTexonicUnknownnonsynonymous SNVNM_032445c.G2695Ap.D899N25.50.001Leblond2019 E
MEGF11     5-0073-003chr15:
66266605-66266626
TAAGAGGAGGGGCTGAGGCGGGTintronicDe novo--Yuen2017 G
MEGF11     NDAR_INVVT972LG7_wes1chr15:
66210324-66210324
AGexonicDe novononsynonymous SNVNM_032445c.T2066Cp.I689T5.042-DeRubeis2014 E
Fu2022 E
Kosmicki2017 E
Lim2017 E
Satterstrom2020 E
MEGF11     AU2000305chr15:
66310794-66310794
GAintronicDe novo--Yuen2017 G
MEGF11     1-0629-003chr15:
66373105-66373105
CTintronicDe novo--Yuen2017 G
MEGF11     AU3808304chr15:
66353674-66353678
GTTTTGTTintronicDe novo--Yuen2017 G
MEGF11     1-0458-003chr15:
66362067-66362067
TCintronicDe novo--Yuen2017 G
MEGF11     Codina-Sola2015:ASD_7chr15:
66210326-66210326
CTexonicMaternalstopgainNM_032445c.G2064Ap.W688X40.0-Codina-Sola2015 E
MEGF11     AU4012302chr15:
66566868-66566868
GAintergenicDe novo--Yuen2017 G
MEGF11     A31chr15:
66301393-66301393
ACintronicDe novo--Wu2018 G
MEGF11     Uddin2014:28chr15:
66198459-66198459
GAexonicDe novononsynonymous SNVNM_032445c.C2731Tp.R911C16.381.0E-4Uddin2014 E
MEGF11     AU3997302chr15:
66491015-66491015
GAintronicDe novo--Yuen2017 G
MEGF11     Lim2017:5333chr15:
66208524-66208524
GAexonicDe novononsynonymous SNVNM_032445c.C2306Tp.T769I20.7-Lim2017 E
MEGF11     SSC04732chr15:
66198459-66198459
GAexonicMosaicnonsynonymous SNVNM_032445c.C2731Tp.R911C16.381.0E-4Lim2017 E
MEGF11     2-0310-004chr15:
66229243-66229243
GAintronicDe novo--Yuen2017 G
MEGF11     1-0142-005chr15:
66341143-66341143
TCintronicDe novo--Yuen2017 G
MEGF11     1-0045-003chr15:
66370504-66370505
CACintronicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More