or
or
Exact

Results for "CDC42BPA"

Variant Events: 26

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
CDC42BPA     2-0320-003chr1:
227746250-227746250
CTintergenicDe novo--Yuen2017 G
CDC42BPA     2-1066-004chr1:
227601527-227601527
TCintergenicDe novo--Yuen2017 G
CDC42BPA     1-0067-005chr1:
227296345-227296345
ACintronicDe novo--Yuen2017 G
CDC42BPA     2-1302-003chr1:
227181988-227181988
CGexonicDe novononsynonymous SNVNM_014826
NM_003607
c.G4898C
c.G5141C
p.R1633P
p.R1714P
23.2-Yuen2017 G
CDC42BPA     AU3861301chr1:
227599392-227599392
GAintergenicDe novo--Yuen2017 G
CDC42BPA     AU3900301chr1:
227246961-227246961
TCintronicDe novo--Yuen2017 G
CDC42BPA     111304chr1:
227262042-227262042
CTexonicnonsynonymous SNVNM_014826
NM_003607
c.G2261A
c.G2504A
p.R754Q
p.R835Q
36.0-Woodbury-Smith2022 E
CDC42BPA     2-0110-003chr1:
227473477-227473477
GAintronicDe novo--Yuen2016 G
Yuen2017 G
CDC42BPA     2-0013-003chr1:
227198437-227198437
GGGAAintronicDe novo--Yuen2017 G
CDC42BPA     1-0382-003chr1:
227485966-227485966
CTintronicDe novo--Yuen2017 G
CDC42BPA     AU038204chr1:
227466016-227466016
CTintronicDe novo--Yuen2017 G
CDC42BPA     12015.p1chr1:
227335241-227335241
ACexonicDe novononsynonymous SNVNM_003607
NM_014826
c.T713G
c.T713G
p.V238G
p.V238G
24.92.0E-4Satterstrom2020 E
CDC42BPA     1-0558-003chr1:
227722190-227722219
CTGTGTGTGTGTGTGTTTGTGTGTGTGTGTCTGTGTGTGTGTGTTTGTGTGTGTGTGTintergenicDe novo--Yuen2017 G
CDC42BPA     5-0025-004chr1:
227482434-227482434
GAintronicDe novo--Yuen2017 G
CDC42BPA     CC940.201chr1:
227239609-227239609
GAintronicDe novo10.22-Satterstrom2020 E
CDC42BPA     UK10K_SKUSE5080268chr1:
227307548-227307548
TGexonicDe novononsynonymous SNVNM_003607
NM_014826
c.A1604C
c.A1604C
p.K535T
p.K535T
25.5-DeRubeis2014 E
Kosmicki2017 E
Lim2017 E
Satterstrom2020 E
CDC42BPA     AU031004chr1:
227561892-227561892
AGintergenicDe novo--Yuen2017 G
CDC42BPA     1-0656-003chr1:
227187925-227187929
TCCCCTCCCCCintronicDe novo--Yuen2017 G
CDC42BPA     2-0208-003chr1:
227456323-227456323
AAGintronicDe novo--Yuen2017 G
CDC42BPA     7-0249-003chr1:
227684988-227684988
GAintergenicDe novo--Yuen2017 G
CDC42BPA     7-0223-003chr1:
227319654-227319654
GAintronicDe novo--Yuen2017 G
CDC42BPA     AU072004chr1:
227664730-227664730
ACintergenicDe novo--Yuen2017 G
CDC42BPA     AU3857301chr1:
227241958-227241958
AGintronicDe novo--Yuen2017 G
CDC42BPA     AU2525302chr1:
227432970-227432970
GAintronicDe novo--Yuen2017 G
CDC42BPA     5-0129-003chr1:
227744540-227744540
TCintergenicDe novo--Yuen2017 G
CDC42BPA     AU2156303chr1:
227611576-227611576
CAintergenicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More