or
or
Exact

Results for "CNNM2"

Variant Events: 23

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
CNNM2     2-1350-003chr10:
104754903-104754903
CCTCCCCCTCCCCCTCCTCTintronicDe novo--Yuen2017 G
CNNM2     3-0018-000chr10:
104836591-104836591
AGintronicDe novo--Yuen2017 G
CNNM2     2-1461-003chr10:
104783695-104783695
GAintronicDe novo--Yuen2017 G
CNNM2     P033chr10:
104678391-104678391
CTexonicUnknownnonsynonymous SNVNM_017649
NM_199076
NM_199077
c.C154T
c.C154T
c.C154T
p.L52F
p.L52F
p.L52F
14.27-Long2019 ET
CNNM2     AU3794302chr10:
104734755-104734755
CAintronicDe novo--Yuen2017 G
CNNM2     2-1454-003chr10:
104747073-104747093
CTTATTATTATTATTATTATTCTTATTATTATTATTATTintronicDe novo--Yuen2017 G
CNNM2     AU3636301chr10:
104703667-104703667
AGintronicDe novo--Yuen2017 G
CNNM2     AU041Achr10:
104835900-104835900
GAexonicDe novononsynonymous SNVNM_199076
NM_017649
c.G2225A
c.G2291A
p.R742Q
p.R764Q
24.0-DeRubeis2014 E
Fu2022 E
Kosmicki2017 E
Satterstrom2020 E
CNNM2     12568.p1chr10:
104713586-104713586
GAintronicDe novo--Turner2016 G
CNNM2     AU4463303chr10:
104719204-104719204
TAintronicDe novo--Yuen2017 G
CNNM2     1-0299-003chr10:
104808249-104808249
AGintronicDe novo--Yuen2017 G
CNNM2     AU3053301chr10:
104767260-104767260
GAintronicDe novo--Yuen2017 G
CNNM2     AU2458303chr10:
104782108-104782115
CTTTTTTTCTTTTTTintronicDe novo--Yuen2017 G
CNNM2     SP0096688chr10:
104809491-104809491
GAexonicDe novononsynonymous SNVNM_017649
NM_199076
c.G1649A
c.G1649A
p.R550Q
p.R550Q
28.88.282E-6Fu2022 E
CNNM2     SP0031140chr10:
104679190-104679190
CTexonicDe novononsynonymous SNVNM_017649
NM_199076
NM_199077
c.C953T
c.C953T
c.C953T
p.S318L
p.S318L
p.S318L
24.2-Fu2022 E
CNNM2     SP0046549chr10:
104809451-104809451
CGintronicDe novo--Fu2022 E
CNNM2     SP0124483chr10:
104809536-104809536
GAexonicDe novononsynonymous SNVNM_017649
NM_199076
c.G1694A
c.G1694A
p.G565E
p.G565E
32.0-Fu2022 E
CNNM2     AU3724302chr10:
104700773-104700777
CTTTTCTTTTTintronicDe novo--Yuen2017 G
CNNM2     369-07-108784chr10:
104678569-104678569
AGexonicDe novononsynonymous SNVNM_017649
NM_199076
NM_199077
c.A332G
c.A332G
c.A332G
p.N111S
p.N111S
p.N111S
10.45-Fu2022 E
Satterstrom2020 E
CNNM2     AU2485305chr10:
104793222-104793227
CAAATACAintronicDe novo--Yuen2017 G
CNNM2     AU4237301chr10:
104670654-104670654
AGintergenicDe novo--Yuen2017 G
CNNM2     969_15auchr10:
104836885-104836885
GAexonicDe novononsynonymous SNVNM_199076
NM_017649
c.G2510A
c.G2576A
p.C837Y
p.C859Y
22.3-Fu2022 E
CNNM2     1-0285-004chr10:
104831077-104831077
GCintronicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More