or
or
Exact

Results for "KCND2"

Variant Events: 37

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
KCND2     1-0469-003chr7:
120226065-120226065
CGintronicDe novo--Yuen2017 G
KCND2     AU1698301chr7:
120183624-120183624
TCintronicDe novo--Yuen2017 G
KCND2     2-0297-004chr7:
120016219-120016219
ATintronicDe novo--Yuen2017 G
KCND2     AU3761302chr7:
120223436-120223436
AGintronicDe novo--Yuen2017 G
KCND2     2-1066-003chr7:
120034470-120034470
TCintronicDe novo--Yuen2017 G
KCND2     AU1987301chr7:
120175947-120175947
GAintronicDe novo--Yuen2017 G
KCND2     AU011903chr7:
120363419-120363419
GAintronicDe novo--Yuen2017 G
KCND2     3-0391-000chr7:
119952252-119952252
TCintronicDe novo--Yuen2017 G
KCND2     AU3857301chr7:
119973245-119973245
CTintronicDe novo--Yuen2017 G
KCND2     2-1242-003chr7:
120290624-120290624
TGintronicDe novo--Yuen2017 G
KCND2     1-0265-004chr7:
120178489-120178489
CTintronicDe novo--Yuen2017 G
KCND2     AU4392301chr7:
120131181-120131181
AGintronicDe novo--Yuen2017 G
KCND2     AU4479301chr7:
120389511-120389511
ACUTR3De novo--Yuen2017 G
KCND2     Lee2014:1chr7:
120373051-120373051
GAexonicDe novononsynonymous SNVNM_012281c.G1210Ap.V404M28.2-Lee2014 E
KCND2     13543.p1chr7:
120157924-120157924
AGintronicDe novo--Turner2016 G
KCND2     13324.p1chr7:
120230325-120230325
GAintronicDe novo--Turner2016 G
KCND2     Lee2014:2chr7:
120373051-120373051
GAexonicDe novononsynonymous SNVNM_012281c.G1210Ap.V404M28.2-Lee2014 E
KCND2     1-0265-003chr7:
120178489-120178489
CTintronicDe novo--Yuen2017 G
KCND2     1-0299-003chr7:
120227914-120227914
GAintronicDe novo--Yuen2017 G
KCND2     12449.p1chr7:
120011185-120011185
AGintronicDe novo--Turner2016 G
KCND2     2-1442-003chr7:
119914135-119914135
GTUTR5De novo--Yuen2017 G
KCND2     AU054303chr7:
120131632-120131632
GTintronicDe novo--Yuen2017 G
KCND2     2-1239-003chr7:
120371705-120371705
AGintronicDe novo--Yuen2017 G
KCND2     EGAN00001100988chr7:
119915017-119915017
TTAAexonicDe novostopgainNM_012281c.331_332insAAp.C111_I112delinsX--Satterstrom2020 E
KCND2     AU3728301chr7:
120321811-120321811
ATintronicDe novo--Yuen2017 G
KCND2     AU4392302chr7:
120131181-120131181
AGintronicDe novo--Yuen2017 G
KCND2     2-1186-003chr7:
120027473-120027473
AGintronicDe novo--Yuen2016 G
Yuen2017 G
KCND2     2-1592-003chr7:
120209941-120209941
GAintronicDe novo--Yuen2017 G
KCND2     1-0181-004chr7:
120008781-120008781
AGintronicDe novo--Yuen2017 G
KCND2     2-1266-003chr7:
119973863-119973863
GAintronicDe novo--Yuen2016 G
Yuen2017 G
KCND2     AU030103chr7:
120221997-120221997
AGintronicDe novo--Yuen2017 G
KCND2     7-0127-003chr7:
120256276-120256276
ATintronicDe novo--Yuen2017 G
KCND2     A15chr7:
120114226-120114227
GCGintronicDe novo--Wu2018 G
KCND2     7-0191-003chr7:
120314501-120314501
AATGAATTAAATAATGTAAATintronicDe novo--Yuen2017 G
KCND2     1-0400-003chr7:
120237813-120237813
CGintronicDe novo--Yuen2017 G
KCND2     AU4487302chr7:
120367697-120367697
GAintronicDe novo--Yuen2017 G
KCND2     1-0923-003chr7:
120305215-120305215
AGintronicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More